Incidental Mutation 'R0278:Olfr1043'
ID24445
Institutional Source Beutler Lab
Gene Symbol Olfr1043
Ensembl Gene ENSMUSG00000075201
Gene Nameolfactory receptor 1043
SynonymsMOR185-7, GA_x6K02T2Q125-47631900-47630956
MMRRC Submission 038500-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R0278 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location86161890-86167522 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 86162579 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 123 (Y123*)
Ref Sequence ENSEMBL: ENSMUSP00000149716 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099907] [ENSMUST00000099908] [ENSMUST00000213886] [ENSMUST00000213949] [ENSMUST00000215624] [ENSMUST00000216028]
Predicted Effect probably null
Transcript: ENSMUST00000099907
AA Change: Y123*
SMART Domains Protein: ENSMUSP00000097491
Gene: ENSMUSG00000075201
AA Change: Y123*

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 6.9e-46 PFAM
Pfam:7tm_1 41 290 1.5e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000099908
SMART Domains Protein: ENSMUSP00000097492
Gene: ENSMUSG00000075202

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 1.2e-48 PFAM
Pfam:7tm_1 41 290 1.3e-14 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000213886
AA Change: Y123*
Predicted Effect probably null
Transcript: ENSMUST00000213949
AA Change: Y123*
Predicted Effect probably benign
Transcript: ENSMUST00000215624
Predicted Effect probably null
Transcript: ENSMUST00000216028
AA Change: Y123*
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 95.4%
  • 20x: 90.7%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,378,215 S3429R probably damaging Het
Abca3 A G 17: 24,381,920 D436G probably benign Het
Acacb C A 5: 114,233,259 Y1816* probably null Het
Acer3 T C 7: 98,261,597 Y86C probably damaging Het
Adgre1 A G 17: 57,447,872 I657V probably benign Het
Akap1 A G 11: 88,845,194 V214A probably benign Het
Ankrd42 T C 7: 92,631,657 R22G possibly damaging Het
Apc2 C T 10: 80,312,813 P1234S possibly damaging Het
Atp13a4 A G 16: 29,454,834 I441T probably damaging Het
Cenpu G A 8: 46,578,309 A242T probably damaging Het
Col6a6 A T 9: 105,767,288 V1267E possibly damaging Het
Crhr2 T C 6: 55,117,531 T58A probably benign Het
Ddx6 T G 9: 44,631,425 C385G probably damaging Het
Dnah7a A T 1: 53,504,146 N2288K probably benign Het
Egfl8 A T 17: 34,614,368 probably null Het
Elmo2 A T 2: 165,297,367 I420N probably damaging Het
Elovl4 A G 9: 83,783,195 F113L probably benign Het
Fancd2 T A 6: 113,548,448 probably null Het
Fbxl13 A G 5: 21,523,910 V456A probably benign Het
Fgfr2 A T 7: 130,261,862 probably null Het
Fkbpl A T 17: 34,645,410 R51* probably null Het
Fn3krp G A 11: 121,421,580 V40M probably damaging Het
Fnip1 A G 11: 54,489,343 probably null Het
Gm15446 A T 5: 109,943,415 Q511L probably benign Het
Gm7334 A G 17: 50,699,261 K192E probably damaging Het
H2-Q10 A T 17: 35,473,307 T282S possibly damaging Het
Hspa9 A G 18: 34,940,910 V482A possibly damaging Het
Ica1l A T 1: 60,013,996 S128T probably benign Het
Il7r A T 15: 9,516,337 I126K probably damaging Het
Kcnj8 T C 6: 142,570,348 E11G probably benign Het
Klkb1 A C 8: 45,272,409 F498V probably benign Het
Lama1 A G 17: 67,810,183 E2491G probably null Het
Lhfpl2 T C 13: 94,174,435 V71A probably benign Het
Lin9 T C 1: 180,665,923 I198T probably damaging Het
Lrrc7 T A 3: 158,179,795 M431L possibly damaging Het
Nmt2 A G 2: 3,325,387 T519A probably benign Het
Olfr1247 A T 2: 89,609,763 L113Q probably damaging Het
Olfr1247 G T 2: 89,609,764 L113M probably damaging Het
Olfr1490 C A 19: 13,654,764 L112I probably damaging Het
Olfr1490 T A 19: 13,654,765 L112H probably damaging Het
Olfr412 T C 11: 74,365,202 F178L probably damaging Het
Olfr871 G T 9: 20,212,886 C179F probably damaging Het
Parp4 A G 14: 56,607,523 R624G probably damaging Het
Pex16 C T 2: 92,381,056 P325S probably damaging Het
Pik3ca T C 3: 32,439,753 M288T possibly damaging Het
Pla2g5 C T 4: 138,800,656 D100N probably benign Het
Prss43 T A 9: 110,827,362 M39K probably benign Het
Psd4 T C 2: 24,394,438 S105P probably damaging Het
Ptprz1 T A 6: 23,000,817 S969T probably benign Het
Rad23b T A 4: 55,383,575 probably null Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rpl10l A G 12: 66,284,356 M1T probably null Het
Sec16a A G 2: 26,428,316 S1588P probably damaging Het
Sh3rf1 A T 8: 61,374,018 H602L probably damaging Het
Sparcl1 A T 5: 104,088,397 S497T probably benign Het
Spata13 A G 14: 60,692,088 Y365C probably benign Het
Trim5 T C 7: 104,279,675 N20D probably benign Het
Vmn1r201 G T 13: 22,475,024 W136L probably damaging Het
Vmn2r112 A G 17: 22,603,006 I222V probably benign Het
Vmn2r56 A T 7: 12,715,717 V198D probably damaging Het
Wapl A G 14: 34,692,612 D477G possibly damaging Het
Zfp202 C A 9: 40,208,482 H194N probably benign Het
Zfp212 C T 6: 47,926,519 R13W probably damaging Het
Other mutations in Olfr1043
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00925:Olfr1043 APN 2 86162920 missense probably benign 0.01
IGL02037:Olfr1043 APN 2 86162837 missense probably benign
IGL02174:Olfr1043 APN 2 86162098 missense possibly damaging 0.78
IGL02511:Olfr1043 APN 2 86162019 missense probably benign 0.00
IGL02578:Olfr1043 APN 2 86162729 nonsense probably null
IGL03084:Olfr1043 APN 2 86162225 nonsense probably null
R0633:Olfr1043 UTSW 2 86162091 missense probably damaging 1.00
R0972:Olfr1043 UTSW 2 86162304 missense possibly damaging 0.94
R1033:Olfr1043 UTSW 2 86162850 missense possibly damaging 0.67
R2116:Olfr1043 UTSW 2 86162729 nonsense probably null
R2998:Olfr1043 UTSW 2 86162020 missense probably benign
R3951:Olfr1043 UTSW 2 86162618 nonsense probably null
R5147:Olfr1043 UTSW 2 86162034 missense possibly damaging 0.79
R6193:Olfr1043 UTSW 2 86162284 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- ATTGAACCCAGCCATGCTCAGC -3'
(R):5'- TACCTCCTGTGTCACGCCAAATGC -3'

Sequencing Primer
(F):5'- GCCATGAGAGGAATGTCTTCAC -3'
(R):5'- CACGCCAAATGCGCTGG -3'
Posted On2013-04-16