Incidental Mutation 'R2303:Gnrhr'
ID244489
Institutional Source Beutler Lab
Gene Symbol Gnrhr
Ensembl Gene ENSMUSG00000029255
Gene Namegonadotropin releasing hormone receptor
Synonyms
MMRRC Submission 040302-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.099) question?
Stock #R2303 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location86180754-86197901 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 86197749 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 26 (G26D)
Ref Sequence ENSEMBL: ENSMUSP00000092238 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031172] [ENSMUST00000094654] [ENSMUST00000113372]
Predicted Effect probably benign
Transcript: ENSMUST00000031172
AA Change: G26D

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000031172
Gene: ENSMUSG00000029255
AA Change: G26D

DomainStartEndE-ValueType
Pfam:7tm_1 63 322 2.8e-40 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000094654
AA Change: G26D

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000092238
Gene: ENSMUSG00000029255
AA Change: G26D

DomainStartEndE-ValueType
Pfam:7tm_1 62 261 6.7e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113372
AA Change: G26D

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000108999
Gene: ENSMUSG00000029255
AA Change: G26D

DomainStartEndE-ValueType
Pfam:7tm_1 60 177 4.5e-20 PFAM
Meta Mutation Damage Score 0.048 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 94.9%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the receptor for type 1 gonadotropin-releasing hormone. This receptor is a member of the seven-transmembrane, G-protein coupled receptor (GPCR) family. It is expressed on the surface of pituitary gonadotrope cells as well as lymphocytes, breast, ovary, and prostate. Following binding of gonadotropin-releasing hormone, the receptor associates with G-proteins that activate a phosphatidylinositol-calcium second messenger system. Activation of the receptor ultimately causes the release of gonadotropic luteinizing hormone (LH) and follicle stimulating hormone (FSH). Defects in this gene are a cause of hypogonadotropic hypogonadism (HH). Alternative splicing results in multiple transcript variants encoding different isoforms. More than 18 transcription initiation sites in the 5' region and multiple polyA signals in the 3' region have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice display prepubescent internal reproductive tracts with hypogonadism and hypogonadotrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930583I09Rik T G 17: 64,834,566 D14A unknown Het
Aars C A 8: 111,052,502 T756K possibly damaging Het
Abca9 A T 11: 110,158,226 M252K probably benign Het
Acan A G 7: 79,099,957 E1492G probably benign Het
Arid1a C A 4: 133,687,251 R1223L unknown Het
Ash1l T C 3: 89,026,426 L2003S probably damaging Het
Cct8 A T 16: 87,490,332 probably null Het
Dagla T C 19: 10,252,103 T598A probably damaging Het
Ercc3 A G 18: 32,245,547 I194V probably benign Het
Fbxo46 A G 7: 19,136,616 N387D possibly damaging Het
Fn1 C T 1: 71,614,036 probably null Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Hmcn1 A T 1: 150,704,226 L1920Q probably damaging Het
Kank2 T A 9: 21,769,765 I823F probably benign Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Kdm1b TCATTGTCC TCATTGTCCATTGTCC 13: 47,064,088 probably null Het
Mfsd6 T A 1: 52,676,513 N535I probably damaging Het
Mgat5 T C 1: 127,446,299 Y479H probably benign Het
Ncoa7 G A 10: 30,654,435 T701I probably damaging Het
Olfr791 T C 10: 129,527,049 V274A probably benign Het
Pcdh18 T C 3: 49,755,274 R531G probably damaging Het
Pcdhb6 A G 18: 37,336,231 H51R probably damaging Het
Pdik1l G A 4: 134,284,248 Q95* probably null Het
Ppp4r3b A T 11: 29,200,741 H469L possibly damaging Het
Prnp A G 2: 131,937,126 T233A probably benign Het
Rcan1 T C 16: 92,393,596 T152A possibly damaging Het
Sema3g T C 14: 31,222,615 F329L probably damaging Het
Setd1a G A 7: 127,799,155 probably benign Het
Slc40a1 G A 1: 45,910,884 probably benign Het
Slco5a1 C T 1: 12,879,262 G635S probably damaging Het
Spg11 C T 2: 122,068,837 C1589Y probably damaging Het
Stab1 T C 14: 31,146,070 T1616A probably damaging Het
Trappc11 A G 8: 47,503,416 Y842H probably damaging Het
Vwde T A 6: 13,215,807 probably benign Het
Zcchc8 A G 5: 123,700,597 L626P probably benign Het
Zfhx4 A G 3: 5,397,060 H1240R probably damaging Het
Other mutations in Gnrhr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00980:Gnrhr APN 5 86197303 critical splice donor site probably null
IGL01432:Gnrhr APN 5 86182193 missense probably damaging 1.00
IGL02702:Gnrhr APN 5 86182269 missense possibly damaging 0.69
IGL03367:Gnrhr APN 5 86182331 missense probably benign 0.02
R0483:Gnrhr UTSW 5 86197575 missense probably damaging 1.00
R1873:Gnrhr UTSW 5 86182201 missense probably damaging 1.00
R2199:Gnrhr UTSW 5 86197818 missense probably benign 0.26
R4400:Gnrhr UTSW 5 86182249 unclassified probably null
R5273:Gnrhr UTSW 5 86182246 missense possibly damaging 0.86
R5320:Gnrhr UTSW 5 86197614 missense possibly damaging 0.95
R6159:Gnrhr UTSW 5 86182357 missense probably damaging 1.00
R6221:Gnrhr UTSW 5 86185403 nonsense probably null
R6629:Gnrhr UTSW 5 86182309 missense probably benign 0.01
R6725:Gnrhr UTSW 5 86185313 missense probably damaging 0.97
X0018:Gnrhr UTSW 5 86197755 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- GTGGCATGACGATCAGAGTC -3'
(R):5'- TGTGACGTTTCCATCTAAAGGAGG -3'

Sequencing Primer
(F):5'- ATCAGAGTCTCCAGCAGGTTG -3'
(R):5'- GTTTCCATCTAAAGGAGGCAGACATC -3'
Posted On2014-10-30