Incidental Mutation 'R0278:Pik3ca'
ID24450
Institutional Source Beutler Lab
Gene Symbol Pik3ca
Ensembl Gene ENSMUSG00000027665
Gene Namephosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit alpha
SynonymscaPI3K, 6330412C24Rik, p110alpha
MMRRC Submission 038500-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0278 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location32397671-32468486 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 32439753 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 288 (M288T)
Ref Sequence ENSEMBL: ENSMUSP00000103878 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029201] [ENSMUST00000108242] [ENSMUST00000108243]
Predicted Effect possibly damaging
Transcript: ENSMUST00000029201
AA Change: M288T

PolyPhen 2 Score 0.595 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000029201
Gene: ENSMUSG00000027665
AA Change: M288T

DomainStartEndE-ValueType
PI3K_p85B 31 108 3.03e-46 SMART
PI3K_rbd 173 292 5e-47 SMART
PI3K_C2 322 425 2.39e-35 SMART
C2 333 441 3.95e-1 SMART
PI3Ka 518 704 8.35e-99 SMART
Blast:PI3Kc 733 766 1e-11 BLAST
PI3Kc 798 1065 8.82e-130 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000108242
AA Change: M166T

PolyPhen 2 Score 0.595 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000103877
Gene: ENSMUSG00000027665
AA Change: M166T

DomainStartEndE-ValueType
PI3K_rbd 51 170 5e-47 SMART
PI3K_C2 200 303 2.39e-35 SMART
C2 211 319 3.95e-1 SMART
PI3Ka 396 582 8.35e-99 SMART
Blast:PI3Kc 611 644 1e-11 BLAST
PI3Kc 676 943 8.82e-130 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000108243
AA Change: M288T

PolyPhen 2 Score 0.595 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000103878
Gene: ENSMUSG00000027665
AA Change: M288T

DomainStartEndE-ValueType
PI3K_p85B 31 108 3.03e-46 SMART
PI3K_rbd 173 292 5e-47 SMART
PI3K_C2 322 425 2.39e-35 SMART
C2 333 441 3.95e-1 SMART
PI3Ka 518 704 8.35e-99 SMART
Blast:PI3Kc 733 766 1e-11 BLAST
PI3Kc 798 1065 8.82e-130 SMART
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 95.4%
  • 20x: 90.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphatidylinositol 3-kinase is composed of an 85 kDa regulatory subunit and a 110 kDa catalytic subunit. The protein encoded by this gene represents the catalytic subunit, which uses ATP to phosphorylate PtdIns, PtdIns4P and PtdIns(4,5)P2. This gene has been found to be oncogenic and has been implicated in cervical cancers. A pseudogene of this gene has been defined on chromosome 22. [provided by RefSeq, Apr 2016]
PHENOTYPE: Homozygous null or knock-in mutations of this gene lead to embryonic death associated with growth retardation, vascular defects and hemorrhage. Surviving mice homozygous for a knock-in allele show impaired lymphangiogenesis, ascites, reduced weight, and resistance to Ras-driven skin tumorigenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,378,215 S3429R probably damaging Het
Abca3 A G 17: 24,381,920 D436G probably benign Het
Acacb C A 5: 114,233,259 Y1816* probably null Het
Acer3 T C 7: 98,261,597 Y86C probably damaging Het
Adgre1 A G 17: 57,447,872 I657V probably benign Het
Akap1 A G 11: 88,845,194 V214A probably benign Het
Ankrd42 T C 7: 92,631,657 R22G possibly damaging Het
Apc2 C T 10: 80,312,813 P1234S possibly damaging Het
Atp13a4 A G 16: 29,454,834 I441T probably damaging Het
Cenpu G A 8: 46,578,309 A242T probably damaging Het
Col6a6 A T 9: 105,767,288 V1267E possibly damaging Het
Crhr2 T C 6: 55,117,531 T58A probably benign Het
Ddx6 T G 9: 44,631,425 C385G probably damaging Het
Dnah7a A T 1: 53,504,146 N2288K probably benign Het
Egfl8 A T 17: 34,614,368 probably null Het
Elmo2 A T 2: 165,297,367 I420N probably damaging Het
Elovl4 A G 9: 83,783,195 F113L probably benign Het
Fancd2 T A 6: 113,548,448 probably null Het
Fbxl13 A G 5: 21,523,910 V456A probably benign Het
Fgfr2 A T 7: 130,261,862 probably null Het
Fkbpl A T 17: 34,645,410 R51* probably null Het
Fn3krp G A 11: 121,421,580 V40M probably damaging Het
Fnip1 A G 11: 54,489,343 probably null Het
Gm15446 A T 5: 109,943,415 Q511L probably benign Het
Gm7334 A G 17: 50,699,261 K192E probably damaging Het
H2-Q10 A T 17: 35,473,307 T282S possibly damaging Het
Hspa9 A G 18: 34,940,910 V482A possibly damaging Het
Ica1l A T 1: 60,013,996 S128T probably benign Het
Il7r A T 15: 9,516,337 I126K probably damaging Het
Kcnj8 T C 6: 142,570,348 E11G probably benign Het
Klkb1 A C 8: 45,272,409 F498V probably benign Het
Lama1 A G 17: 67,810,183 E2491G probably null Het
Lhfpl2 T C 13: 94,174,435 V71A probably benign Het
Lin9 T C 1: 180,665,923 I198T probably damaging Het
Lrrc7 T A 3: 158,179,795 M431L possibly damaging Het
Nmt2 A G 2: 3,325,387 T519A probably benign Het
Olfr1043 A T 2: 86,162,579 Y123* probably null Het
Olfr1247 A T 2: 89,609,763 L113Q probably damaging Het
Olfr1247 G T 2: 89,609,764 L113M probably damaging Het
Olfr1490 C A 19: 13,654,764 L112I probably damaging Het
Olfr1490 T A 19: 13,654,765 L112H probably damaging Het
Olfr412 T C 11: 74,365,202 F178L probably damaging Het
Olfr871 G T 9: 20,212,886 C179F probably damaging Het
Parp4 A G 14: 56,607,523 R624G probably damaging Het
Pex16 C T 2: 92,381,056 P325S probably damaging Het
Pla2g5 C T 4: 138,800,656 D100N probably benign Het
Prss43 T A 9: 110,827,362 M39K probably benign Het
Psd4 T C 2: 24,394,438 S105P probably damaging Het
Ptprz1 T A 6: 23,000,817 S969T probably benign Het
Rad23b T A 4: 55,383,575 probably null Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rpl10l A G 12: 66,284,356 M1T probably null Het
Sec16a A G 2: 26,428,316 S1588P probably damaging Het
Sh3rf1 A T 8: 61,374,018 H602L probably damaging Het
Sparcl1 A T 5: 104,088,397 S497T probably benign Het
Spata13 A G 14: 60,692,088 Y365C probably benign Het
Trim5 T C 7: 104,279,675 N20D probably benign Het
Vmn1r201 G T 13: 22,475,024 W136L probably damaging Het
Vmn2r112 A G 17: 22,603,006 I222V probably benign Het
Vmn2r56 A T 7: 12,715,717 V198D probably damaging Het
Wapl A G 14: 34,692,612 D477G possibly damaging Het
Zfp202 C A 9: 40,208,482 H194N probably benign Het
Zfp212 C T 6: 47,926,519 R13W probably damaging Het
Other mutations in Pik3ca
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01284:Pik3ca APN 3 32462584 missense probably damaging 1.00
IGL01894:Pik3ca APN 3 32450026 missense possibly damaging 0.91
IGL03118:Pik3ca APN 3 32459935 missense probably damaging 1.00
IGL03184:Pik3ca APN 3 32439886 missense probably benign 0.27
IGL03401:Pik3ca APN 3 32437814 splice site probably null
Peninsular UTSW 3 32462821 missense probably benign 0.38
R0084:Pik3ca UTSW 3 32462788 missense possibly damaging 0.78
R0116:Pik3ca UTSW 3 32459945 missense probably damaging 1.00
R0513:Pik3ca UTSW 3 32461511 missense probably damaging 1.00
R0543:Pik3ca UTSW 3 32450261 critical splice acceptor site probably null
R0622:Pik3ca UTSW 3 32436552 missense probably damaging 1.00
R0630:Pik3ca UTSW 3 32450027 missense possibly damaging 0.91
R1193:Pik3ca UTSW 3 32456093 missense probably damaging 0.99
R1292:Pik3ca UTSW 3 32454420 missense probably damaging 1.00
R1464:Pik3ca UTSW 3 32461841 missense probably damaging 1.00
R1464:Pik3ca UTSW 3 32461841 missense probably damaging 1.00
R1869:Pik3ca UTSW 3 32450350 missense probably damaging 0.99
R1962:Pik3ca UTSW 3 32443867 missense probably benign 0.27
R1969:Pik3ca UTSW 3 32451754 critical splice acceptor site probably null
R2006:Pik3ca UTSW 3 32450057 missense probably damaging 1.00
R2264:Pik3ca UTSW 3 32437927 missense possibly damaging 0.65
R2366:Pik3ca UTSW 3 32462794 nonsense probably null
R2680:Pik3ca UTSW 3 32436548 nonsense probably null
R2680:Pik3ca UTSW 3 32443885 missense probably benign 0.00
R3001:Pik3ca UTSW 3 32462797 missense probably damaging 1.00
R3002:Pik3ca UTSW 3 32462797 missense probably damaging 1.00
R4303:Pik3ca UTSW 3 32439935 nonsense probably null
R4416:Pik3ca UTSW 3 32461530 missense probably damaging 0.99
R4758:Pik3ca UTSW 3 32437978 missense probably benign 0.20
R4822:Pik3ca UTSW 3 32437982 missense probably benign 0.04
R4856:Pik3ca UTSW 3 32437163 missense probably damaging 1.00
R4886:Pik3ca UTSW 3 32437163 missense probably damaging 1.00
R5297:Pik3ca UTSW 3 32450053 missense probably damaging 1.00
R5636:Pik3ca UTSW 3 32461560 missense probably damaging 1.00
R5663:Pik3ca UTSW 3 32462779 missense probably damaging 1.00
R6249:Pik3ca UTSW 3 32461563 missense probably damaging 1.00
R6264:Pik3ca UTSW 3 32440714 critical splice donor site probably null
R6347:Pik3ca UTSW 3 32462821 missense probably benign 0.38
R6538:Pik3ca UTSW 3 32439704 missense probably damaging 1.00
R7020:Pik3ca UTSW 3 32436279 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TCAGGCTTACCAAAGGAAGCTGC -3'
(R):5'- AGCAAACCTCAGCATTGGCCTTAC -3'

Sequencing Primer
(F):5'- ACAGCTACTATCAAGTGTGGTC -3'
(R):5'- GCATTGGCCTTACCTTATCAATGTC -3'
Posted On2013-04-16