Mutagenetix > Incidental Mutation

Incidental Mutation 'R2304:Rbl1'

244518

Institutional Source

Beutler Lab

Gene Symbol

Rbl1

Ensembl Gene

ENSMUSG00000027641

Gene Name

RB transcriptional corepressor like 1

Synonyms

retinoblastoma-like 1 (p107), p107

MMRRC Submission

040303-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2304 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

156987813-157046454 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 156989551 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 1023 (T1023A)

Ref Sequence

ENSEMBL: ENSMUSP00000029170 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029170]

AlphaFold

Q64701

Predicted Effect

probably benign
Transcript: ENSMUST00000029170
AA Change: T1023A

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000029170
Gene: ENSMUSG00000027641
AA Change: T1023A

Domain	Start	End	E-Value	Type
low complexity region	8	28	N/A	INTRINSIC
DUF3452	70	212	5.14e-78	SMART
RB_A	385	578	9.58e-119	SMART
low complexity region	706	719	N/A	INTRINSIC
CYCLIN	800	934	8.68e-6	SMART
Rb_C	947	1063	2.29e-11	SMART

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.4%
20x: 95.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is similar in sequence and possibly function to the product of the retinoblastoma 1 (RB1) gene. The RB1 gene product is a tumor suppressor protein that appears to be involved in cell cycle regulation, as it is phosphorylated in the S to M phase transition and is dephosphorylated in the G1 phase of the cell cycle. Both the RB1 protein and the product of this gene can form a complex with adenovirus E1A protein and SV40 large T-antigen, with the SV40 large T-antigen binding only to the unphosphorylated form of each protein. In addition, both proteins can inhibit the transcription of cell cycle genes containing E2F binding sites in their promoters. Due to the sequence and biochemical similarities with the RB1 protein, it is thought that the protein encoded by this gene may also be a tumor suppressor. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations are viable and fertile, but may show impaired growth, myeloid hyperplasia in spleen and liver and give rise to cells with a 2X doubling time in vitro. These effects are genetic background dependent. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 23 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam22	T	A	5: 8,142,366 (GRCm39)	R806S	probably damaging	Het
Ccdc187	T	C	2: 26,171,029 (GRCm39)	K483R	possibly damaging	Het
Dcdc5	T	A	2: 106,166,488 (GRCm39)		noncoding transcript	Het
Dvl1	C	T	4: 155,940,041 (GRCm39)	S391F	probably damaging	Het
Erg28	A	G	12: 85,862,937 (GRCm39)	L125P	probably damaging	Het
Gkn3	C	T	6: 87,360,507 (GRCm39)	A163T	probably damaging	Het
Gm5449	G	T	13: 53,679,899 (GRCm39)		noncoding transcript	Het
Grid2ip	T	C	5: 143,373,595 (GRCm39)	Y796H	probably damaging	Het
Mcrip1	A	T	11: 120,435,519 (GRCm39)	F39I	probably damaging	Het
Or5w12	T	A	2: 87,502,238 (GRCm39)	I158L	probably benign	Het
Prss53	T	C	7: 127,487,479 (GRCm39)	N291D	probably benign	Het
Ptpru	A	T	4: 131,499,879 (GRCm39)	V1255D	probably damaging	Het
Rnaseh2b	T	C	14: 62,598,838 (GRCm39)	S188P	probably damaging	Het
Sh2d6	T	C	6: 72,497,542 (GRCm39)	E20G	probably damaging	Het
Slc13a5	A	G	11: 72,149,865 (GRCm39)	V172A	probably damaging	Het
Slco5a1	C	T	1: 12,949,486 (GRCm39)	G635S	probably damaging	Het
Sp8	G	T	12: 118,812,304 (GRCm39)	S53I	possibly damaging	Het
Tns2	C	T	15: 102,017,369 (GRCm39)	R281C	probably damaging	Het
Togaram1	G	T	12: 65,023,630 (GRCm39)		probably null	Het
Trip11	A	T	12: 101,865,236 (GRCm39)	F146I	possibly damaging	Het
Vmn1r184	T	C	7: 25,966,550 (GRCm39)	S99P	probably damaging	Het
Xpot	T	C	10: 121,447,488 (GRCm39)	I325V	probably benign	Het
Zfp786	A	G	6: 47,797,633 (GRCm39)	L435P	probably damaging	Het

Other mutations in Rbl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01413:Rbl1	APN	2	156,994,812 (GRCm39)	splice site	probably null
IGL01418:Rbl1	APN	2	156,994,812 (GRCm39)	splice site	probably null
IGL01597:Rbl1	APN	2	157,037,369 (GRCm39)	splice site	probably benign
IGL01788:Rbl1	APN	2	157,005,576 (GRCm39)	missense	probably benign	0.15
IGL02366:Rbl1	APN	2	157,016,813 (GRCm39)	missense	probably benign	0.18
IGL02527:Rbl1	APN	2	157,035,968 (GRCm39)	missense	probably benign	0.05
IGL02720:Rbl1	APN	2	157,041,349 (GRCm39)	missense	possibly damaging	0.94
IGL02828:Rbl1	APN	2	157,041,384 (GRCm39)	missense	probably damaging	1.00
IGL02926:Rbl1	APN	2	157,009,333 (GRCm39)	missense	probably benign	0.08
IGL02968:Rbl1	APN	2	157,019,194 (GRCm39)	missense	probably damaging	1.00
IGL03284:Rbl1	APN	2	157,035,989 (GRCm39)	splice site	probably benign
R0042:Rbl1	UTSW	2	157,017,624 (GRCm39)	splice site	probably benign
R0089:Rbl1	UTSW	2	157,041,334 (GRCm39)	critical splice donor site	probably null
R0173:Rbl1	UTSW	2	157,001,605 (GRCm39)	missense	probably benign	0.00
R0464:Rbl1	UTSW	2	156,989,465 (GRCm39)	missense	probably damaging	1.00
R1178:Rbl1	UTSW	2	156,989,575 (GRCm39)	missense	possibly damaging	0.92
R1296:Rbl1	UTSW	2	157,011,891 (GRCm39)	missense	probably benign	0.09
R1430:Rbl1	UTSW	2	157,011,826 (GRCm39)	missense	probably benign
R1445:Rbl1	UTSW	2	157,035,018 (GRCm39)	missense	probably benign
R1511:Rbl1	UTSW	2	157,037,554 (GRCm39)	missense	probably damaging	1.00
R1603:Rbl1	UTSW	2	157,017,579 (GRCm39)	missense	possibly damaging	0.75
R1666:Rbl1	UTSW	2	157,001,654 (GRCm39)	missense	probably damaging	1.00
R1668:Rbl1	UTSW	2	157,001,654 (GRCm39)	missense	probably damaging	1.00
R1680:Rbl1	UTSW	2	157,016,703 (GRCm39)	missense	probably damaging	0.97
R1771:Rbl1	UTSW	2	157,005,454 (GRCm39)	splice site	probably null
R1833:Rbl1	UTSW	2	157,037,475 (GRCm39)	missense	probably damaging	0.98
R1852:Rbl1	UTSW	2	157,016,823 (GRCm39)	missense	probably benign	0.01
R3552:Rbl1	UTSW	2	157,037,505 (GRCm39)	missense	probably benign	0.19
R3605:Rbl1	UTSW	2	157,019,153 (GRCm39)	missense	probably damaging	1.00
R3607:Rbl1	UTSW	2	157,019,153 (GRCm39)	missense	probably damaging	1.00
R4160:Rbl1	UTSW	2	157,034,039 (GRCm39)	intron	probably benign
R4423:Rbl1	UTSW	2	157,010,875 (GRCm39)	intron	probably benign
R4636:Rbl1	UTSW	2	157,009,340 (GRCm39)	missense	possibly damaging	0.82
R4780:Rbl1	UTSW	2	157,016,724 (GRCm39)	missense	probably benign	0.43
R4789:Rbl1	UTSW	2	157,019,275 (GRCm39)	missense	probably benign
R5145:Rbl1	UTSW	2	157,017,397 (GRCm39)	intron	probably benign
R5802:Rbl1	UTSW	2	157,003,353 (GRCm39)	missense	probably benign	0.23
R5851:Rbl1	UTSW	2	157,009,245 (GRCm39)	missense	probably benign	0.00
R6742:Rbl1	UTSW	2	157,011,918 (GRCm39)	missense	probably benign	0.19
R6861:Rbl1	UTSW	2	156,994,887 (GRCm39)	missense	probably damaging	1.00
R6943:Rbl1	UTSW	2	157,030,206 (GRCm39)	missense	probably benign
R7090:Rbl1	UTSW	2	156,994,820 (GRCm39)	missense	probably benign	0.02
R7176:Rbl1	UTSW	2	157,030,245 (GRCm39)	missense	probably damaging	1.00
R7769:Rbl1	UTSW	2	157,033,900 (GRCm39)	missense	probably benign	0.01
R8032:Rbl1	UTSW	2	157,029,918 (GRCm39)	nonsense	probably null
R8544:Rbl1	UTSW	2	157,035,124 (GRCm39)	missense	probably damaging	1.00
R8552:Rbl1	UTSW	2	157,038,174 (GRCm39)	missense	probably damaging	1.00
R8802:Rbl1	UTSW	2	157,038,073 (GRCm39)	critical splice donor site	probably null
R8902:Rbl1	UTSW	2	157,041,420 (GRCm39)	missense	probably benign	0.00
R9032:Rbl1	UTSW	2	157,035,073 (GRCm39)	missense	probably benign	0.02
R9401:Rbl1	UTSW	2	157,016,742 (GRCm39)	missense	possibly damaging	0.81
R9420:Rbl1	UTSW	2	157,035,154 (GRCm39)	missense	probably damaging	0.99
R9747:Rbl1	UTSW	2	157,033,966 (GRCm39)	missense	probably damaging	0.99
X0057:Rbl1	UTSW	2	157,030,249 (GRCm39)	nonsense	probably null
X0058:Rbl1	UTSW	2	157,016,733 (GRCm39)	missense	possibly damaging	0.88

Predicted Primers

PCR Primer
(F):5'- AATGTGAAGGATGGAGCCCC -3'
(R):5'- TGCTCCTTCTGGTCTGATTAAAACC -3'

Sequencing Primer
(F):5'- GCCCCAGCTTTCTCCAGAAC -3'
(R):5'- AGCCACCGCTGTAAGTTG -3'

Posted On

2014-10-30