Incidental Mutation 'R2304:0610007P14Rik'
List |< first << previous [record 2 of 386652] next >> last >|
ID244534
Institutional Source Beutler Lab
Gene Symbol 0610007P14Rik
Ensembl Gene ENSMUSG00000021252
Gene NameRIKEN cDNA 0610007P14 gene
SynonymsORF11
MMRRC Submission 040303-MU
Accession Numbers
Stock #R2304 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location85815448-85824550 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 85816163 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 125 (L125P)
Ref Sequence ENSEMBL: ENSMUSP00000021676 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021676]
Predicted Effect probably damaging
Transcript: ENSMUST00000021676
AA Change: L125P

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000021676
Gene: ENSMUSG00000021252
AA Change: L125P

DomainStartEndE-ValueType
Pfam:Erg28 6 115 5.9e-43 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932418E24Rik T C 2: 26,281,017 K483R possibly damaging Het
Adam22 T A 5: 8,092,366 R871S probably damaging Het
Dcdc5 T A 2: 106,336,143 probably null Het
Dvl1 C T 4: 155,855,584 S391F probably damaging Het
Fam179b G T 12: 64,976,856 probably null Het
Fam195b A T 11: 120,544,693 F39I probably damaging Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gm5449 G T 13: 53,525,863 G54V probably damaging Het
Grid2ip T C 5: 143,387,840 Y968H probably damaging Het
Lifr T C 15: 7,186,862 probably benign Het
Olfr1135 T A 2: 87,671,894 I158L probably benign Het
Otog T C 7: 46,251,398 probably benign Het
Prss53 T C 7: 127,888,307 N291D probably benign Het
Ptpru A T 4: 131,772,568 V1265D probably damaging Het
Rbl1 T C 2: 157,147,631 T1023A probably benign Het
Rnaseh2b T C 14: 62,361,389 S188P probably damaging Het
Serac1 G A 17: 6,044,253 probably benign Het
Sh2d6 T C 6: 72,520,559 E20G probably damaging Het
Slc13a5 A G 11: 72,259,039 V215A probably damaging Het
Slco5a1 C T 1: 12,879,262 G635S probably damaging Het
Sp8 G T 12: 118,848,569 S53I possibly damaging Het
Spns1 G A 7: 126,371,165 probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trip11 A T 12: 101,898,977 F147I probably benign Het
Vmn1r184 T C 7: 26,267,125 S99P probably damaging Het
Xpot T C 10: 121,611,583 I326V probably benign Het
Zfp786 A G 6: 47,820,699 L435P probably damaging Het
Other mutations in 0610007P14Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1891:0610007P14Rik UTSW 12 85816188 missense probably benign 0.16
R5427:0610007P14Rik UTSW 12 85819567 missense probably damaging 1.00
R5735:0610007P14Rik UTSW 12 85816152 missense probably benign 0.43
R5778:0610007P14Rik UTSW 12 85819480 missense possibly damaging 0.72
Predicted Primers PCR Primer
(F):5'- CCCTCTCGAAAGCTTAAGATGC -3'
(R):5'- TGTTTGTATTTGGAACAGCAGCTC -3'

Sequencing Primer
(F):5'- CTCTCGAAAGCTTAAGATGCTGAAC -3'
(R):5'- ACAGCAGCTCCCACAGTTGG -3'
Posted OnOct 30, 2014