Incidental Mutation 'R0278:Rad23b'
ID24454
Institutional Source Beutler Lab
Gene Symbol Rad23b
Ensembl Gene ENSMUSG00000028426
Gene NameRAD23 homolog B, nucleotide excision repair protein
Synonyms0610007D13Rik, mHR23B
MMRRC Submission 038500-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0278 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location55350043-55392237 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 55383575 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000030134 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030134]
PDB Structure
The Mouse PNGase-HR23 Complex Reveals a Complete Remodulation of the Protein-Protein Interface Compared to its Yeast Orthologs [X-RAY DIFFRACTION]
The Mouse PNGase-HR23 Complex Reveals a Complete Remodulation of the Protein-Protein Interface Compared to its Yeast Orthologs [X-RAY DIFFRACTION]
Predicted Effect probably null
Transcript: ENSMUST00000030134
SMART Domains Protein: ENSMUSP00000030134
Gene: ENSMUSG00000028426

DomainStartEndE-ValueType
UBQ 1 75 8.79e-24 SMART
low complexity region 79 143 N/A INTRINSIC
UBA 190 227 3.1e-11 SMART
low complexity region 257 270 N/A INTRINSIC
STI1 274 317 3.37e-10 SMART
UBA 373 410 6.35e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156263
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 95.4%
  • 20x: 90.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of two human homologs of Saccharomyces cerevisiae Rad23, a protein involved in the nucleotide excision repair (NER). This protein was found to be a component of the protein complex that specifically complements the NER defect of xeroderma pigmentosum group C (XP-c) cell extracts in vitro. This protein was also shown to interact with, and elevate the nucleotide excision activity of 3-methyladenine-DNA glycosylase (MPG), which suggested a role in DNA damage recognition in base excision repair. This protein contains an N-terminal ubiquitin-like domain, which was reported to interact with 26S proteasome, and thus this protein may be involved in the ubiquitin mediated proteolytic pathway in cells. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Sep 2011]
PHENOTYPE: Mice homozygous for a disruption in this gene usually die around the time of birth. Those that survive show growth retardation, eye, reproductive, behavioral, and digestive system abnormalities. They usually die within 1 year of birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,378,215 S3429R probably damaging Het
Abca3 A G 17: 24,381,920 D436G probably benign Het
Acacb C A 5: 114,233,259 Y1816* probably null Het
Acer3 T C 7: 98,261,597 Y86C probably damaging Het
Adgre1 A G 17: 57,447,872 I657V probably benign Het
Akap1 A G 11: 88,845,194 V214A probably benign Het
Ankrd42 T C 7: 92,631,657 R22G possibly damaging Het
Apc2 C T 10: 80,312,813 P1234S possibly damaging Het
Atp13a4 A G 16: 29,454,834 I441T probably damaging Het
Cenpu G A 8: 46,578,309 A242T probably damaging Het
Col6a6 A T 9: 105,767,288 V1267E possibly damaging Het
Crhr2 T C 6: 55,117,531 T58A probably benign Het
Ddx6 T G 9: 44,631,425 C385G probably damaging Het
Dnah7a A T 1: 53,504,146 N2288K probably benign Het
Egfl8 A T 17: 34,614,368 probably null Het
Elmo2 A T 2: 165,297,367 I420N probably damaging Het
Elovl4 A G 9: 83,783,195 F113L probably benign Het
Fancd2 T A 6: 113,548,448 probably null Het
Fbxl13 A G 5: 21,523,910 V456A probably benign Het
Fgfr2 A T 7: 130,261,862 probably null Het
Fkbpl A T 17: 34,645,410 R51* probably null Het
Fn3krp G A 11: 121,421,580 V40M probably damaging Het
Fnip1 A G 11: 54,489,343 probably null Het
Gm15446 A T 5: 109,943,415 Q511L probably benign Het
Gm7334 A G 17: 50,699,261 K192E probably damaging Het
H2-Q10 A T 17: 35,473,307 T282S possibly damaging Het
Hspa9 A G 18: 34,940,910 V482A possibly damaging Het
Ica1l A T 1: 60,013,996 S128T probably benign Het
Il7r A T 15: 9,516,337 I126K probably damaging Het
Kcnj8 T C 6: 142,570,348 E11G probably benign Het
Klkb1 A C 8: 45,272,409 F498V probably benign Het
Lama1 A G 17: 67,810,183 E2491G probably null Het
Lhfpl2 T C 13: 94,174,435 V71A probably benign Het
Lin9 T C 1: 180,665,923 I198T probably damaging Het
Lrrc7 T A 3: 158,179,795 M431L possibly damaging Het
Nmt2 A G 2: 3,325,387 T519A probably benign Het
Olfr1043 A T 2: 86,162,579 Y123* probably null Het
Olfr1247 A T 2: 89,609,763 L113Q probably damaging Het
Olfr1247 G T 2: 89,609,764 L113M probably damaging Het
Olfr1490 C A 19: 13,654,764 L112I probably damaging Het
Olfr1490 T A 19: 13,654,765 L112H probably damaging Het
Olfr412 T C 11: 74,365,202 F178L probably damaging Het
Olfr871 G T 9: 20,212,886 C179F probably damaging Het
Parp4 A G 14: 56,607,523 R624G probably damaging Het
Pex16 C T 2: 92,381,056 P325S probably damaging Het
Pik3ca T C 3: 32,439,753 M288T possibly damaging Het
Pla2g5 C T 4: 138,800,656 D100N probably benign Het
Prss43 T A 9: 110,827,362 M39K probably benign Het
Psd4 T C 2: 24,394,438 S105P probably damaging Het
Ptprz1 T A 6: 23,000,817 S969T probably benign Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rpl10l A G 12: 66,284,356 M1T probably null Het
Sec16a A G 2: 26,428,316 S1588P probably damaging Het
Sh3rf1 A T 8: 61,374,018 H602L probably damaging Het
Sparcl1 A T 5: 104,088,397 S497T probably benign Het
Spata13 A G 14: 60,692,088 Y365C probably benign Het
Trim5 T C 7: 104,279,675 N20D probably benign Het
Vmn1r201 G T 13: 22,475,024 W136L probably damaging Het
Vmn2r112 A G 17: 22,603,006 I222V probably benign Het
Vmn2r56 A T 7: 12,715,717 V198D probably damaging Het
Wapl A G 14: 34,692,612 D477G possibly damaging Het
Zfp202 C A 9: 40,208,482 H194N probably benign Het
Zfp212 C T 6: 47,926,519 R13W probably damaging Het
Other mutations in Rad23b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01301:Rad23b APN 4 55366774 splice site probably benign
IGL01326:Rad23b APN 4 55383601 missense possibly damaging 0.95
IGL02398:Rad23b APN 4 55350360 utr 5 prime probably benign
IGL02506:Rad23b APN 4 55382511 missense probably benign 0.01
IGL02538:Rad23b APN 4 55370457 missense possibly damaging 0.67
Saguaro UTSW 4 55370474 critical splice donor site probably null
R1846:Rad23b UTSW 4 55383637 nonsense probably null
R2198:Rad23b UTSW 4 55385497 missense possibly damaging 0.68
R2425:Rad23b UTSW 4 55385438 missense probably damaging 0.99
R3774:Rad23b UTSW 4 55382589 missense possibly damaging 0.95
R3781:Rad23b UTSW 4 55382586 missense probably damaging 1.00
R4197:Rad23b UTSW 4 55385455 missense probably damaging 0.98
R5911:Rad23b UTSW 4 55370474 critical splice donor site probably null
R6056:Rad23b UTSW 4 55382540 missense probably benign 0.01
R6067:Rad23b UTSW 4 55370400 missense probably damaging 0.97
R6078:Rad23b UTSW 4 55370400 missense probably damaging 0.97
R6079:Rad23b UTSW 4 55370400 missense probably damaging 0.97
U15987:Rad23b UTSW 4 55370400 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AAAGAGGAGGCGTTGTTCTGGCTC -3'
(R):5'- GGAAGAGGAAGTAAGCCTTTCCCAAAC -3'

Sequencing Primer
(F):5'- CCTACTAGGTAATTTTGGTCCCTGAG -3'
(R):5'- CCTATGTAAGCTGATCAATCGTTC -3'
Posted On2013-04-16