Incidental Mutation 'R2305:Adamts7'
ID 244562
Institutional Source Beutler Lab
Gene Symbol Adamts7
Ensembl Gene ENSMUSG00000032363
Gene Name ADAM metallopeptidase with thrombospondin type 1 motif 7
Synonyms ADAM-TS7
MMRRC Submission 040304-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.081) question?
Stock # R2305 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 90041420-90082155 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 90062764 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 406 (D406G)
Ref Sequence ENSEMBL: ENSMUSP00000115972 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113059] [ENSMUST00000113060] [ENSMUST00000134996] [ENSMUST00000147250] [ENSMUST00000167122]
AlphaFold Q68SA9
Predicted Effect probably benign
Transcript: ENSMUST00000113059
AA Change: D406G

PolyPhen 2 Score 0.148 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000108682
Gene: ENSMUSG00000032363
AA Change: D406G

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Pep_M12B_propep 34 174 1.1e-36 PFAM
low complexity region 203 220 N/A INTRINSIC
Pfam:Reprolysin_5 224 411 1.3e-16 PFAM
Pfam:Reprolysin_4 224 425 8.5e-9 PFAM
Pfam:Reprolysin 226 437 2.2e-27 PFAM
Pfam:Reprolysin_2 244 427 2.9e-12 PFAM
Pfam:Reprolysin_3 248 383 5.2e-13 PFAM
Blast:ACR 442 513 5e-15 BLAST
TSP1 526 578 4.9e-13 SMART
Pfam:ADAM_spacer1 683 794 2.2e-36 PFAM
TSP1 807 863 1.45e-6 SMART
TSP1 866 908 2.41e-1 SMART
TSP1 929 978 1.45e-6 SMART
low complexity region 1011 1025 N/A INTRINSIC
low complexity region 1211 1233 N/A INTRINSIC
TSP1 1385 1435 2.4e-2 SMART
TSP1 1436 1493 1.8e-2 SMART
TSP1 1495 1542 4.82e-2 SMART
TSP1 1543 1600 1.39e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113060
AA Change: D406G

PolyPhen 2 Score 0.148 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000108683
Gene: ENSMUSG00000032363
AA Change: D406G

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Pep_M12B_propep 33 174 3.4e-28 PFAM
low complexity region 203 220 N/A INTRINSIC
Pfam:Reprolysin_5 224 411 1.6e-16 PFAM
Pfam:Reprolysin_4 224 425 8.2e-9 PFAM
Pfam:Reprolysin 226 437 6.4e-30 PFAM
Pfam:Reprolysin_2 244 427 4.6e-12 PFAM
Pfam:Reprolysin_3 248 383 8.1e-13 PFAM
Blast:ACR 442 513 5e-15 BLAST
TSP1 526 578 4.9e-13 SMART
Pfam:ADAM_spacer1 683 794 1.5e-36 PFAM
TSP1 807 863 1.45e-6 SMART
TSP1 866 908 2.41e-1 SMART
low complexity region 969 983 N/A INTRINSIC
low complexity region 1169 1191 N/A INTRINSIC
TSP1 1343 1393 2.4e-2 SMART
TSP1 1394 1451 1.8e-2 SMART
TSP1 1453 1500 4.82e-2 SMART
TSP1 1501 1558 1.39e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000134996
AA Change: D406G

PolyPhen 2 Score 0.153 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000119744
Gene: ENSMUSG00000032363
AA Change: D406G

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Pep_M12B_propep 33 174 2.4e-29 PFAM
low complexity region 203 220 N/A INTRINSIC
Pfam:Reprolysin_5 224 412 1e-17 PFAM
Pfam:Reprolysin_4 224 426 5e-10 PFAM
Pfam:Reprolysin 226 437 3.7e-31 PFAM
Pfam:Reprolysin_2 244 427 3.2e-13 PFAM
Pfam:Reprolysin_3 248 383 6.3e-14 PFAM
Blast:ACR 439 505 7e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000147250
AA Change: D406G

PolyPhen 2 Score 0.394 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000115972
Gene: ENSMUSG00000032363
AA Change: D406G

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Pep_M12B_propep 33 174 2.7e-26 PFAM
low complexity region 203 220 N/A INTRINSIC
Pfam:Reprolysin_5 224 411 1.4e-14 PFAM
Pfam:Reprolysin_4 224 425 7e-7 PFAM
Pfam:Reprolysin 226 437 4.9e-28 PFAM
Pfam:Reprolysin_2 244 427 5e-10 PFAM
Pfam:Reprolysin_3 248 383 6.5e-11 PFAM
ACR 439 515 1.7e-5 SMART
TSP1 526 578 2.3e-15 SMART
Pfam:ADAM_spacer1 683 794 3.5e-34 PFAM
TSP1 807 863 6.9e-9 SMART
TSP1 866 908 1.2e-3 SMART
low complexity region 969 983 N/A INTRINSIC
low complexity region 1169 1191 N/A INTRINSIC
TSP1 1284 1334 1.2e-4 SMART
TSP1 1335 1392 8.7e-5 SMART
TSP1 1394 1441 2.3e-4 SMART
TSP1 1442 1499 6.5e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167122
AA Change: D406G

PolyPhen 2 Score 0.301 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000129292
Gene: ENSMUSG00000032363
AA Change: D406G

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Pep_M12B_propep 33 174 1.4e-28 PFAM
low complexity region 203 220 N/A INTRINSIC
Pfam:Reprolysin_5 224 411 7.2e-17 PFAM
Pfam:Reprolysin_4 224 425 3.6e-9 PFAM
Pfam:Reprolysin 226 437 2.9e-30 PFAM
Pfam:Reprolysin_2 244 427 2.2e-12 PFAM
Pfam:Reprolysin_3 248 383 3.7e-13 PFAM
Blast:ACR 442 513 5e-15 BLAST
TSP1 526 578 4.9e-13 SMART
Pfam:ADAM_spacer1 683 794 1.1e-36 PFAM
TSP1 807 863 1.45e-6 SMART
TSP1 866 908 2.41e-1 SMART
TSP1 929 978 1.45e-6 SMART
low complexity region 1011 1025 N/A INTRINSIC
low complexity region 1211 1233 N/A INTRINSIC
TSP1 1385 1435 2.4e-2 SMART
TSP1 1436 1493 1.8e-2 SMART
TSP1 1495 1542 4.82e-2 SMART
TSP1 1543 1600 1.39e-3 SMART
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 94.8%
Validation Efficiency 100% (32/32)
MGI Phenotype FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. The encoded preproprotein undergoes proteolytic processing to generate an active, zinc-dependent enzyme that degrades cartilage oligomeric matrix protein. The deficiency of the encoded protein decreases atherosclerosis in genetically hyperlipidemic mice and in response to vascular injury. Alternative splicing results in multiple transcript variants encoding different isoforms, some of which may undergo similar processing. [provided by RefSeq, May 2016]
PHENOTYPE: Homozygotes for a null allele show increased lung function parameters, reduced endothelial cell migration and proliferation, increased re-endothelialization and ameliorated neointima formation after carotid artery injury, and increased oval cell activation and biliary fibrosis after liver injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acvr1c C A 2: 58,171,711 (GRCm39) D295Y probably damaging Het
Ankhd1 T C 18: 36,775,979 (GRCm39) S1443P possibly damaging Het
Casp8ap2 A T 4: 32,646,411 (GRCm39) K1828I probably damaging Het
Cep135 T C 5: 76,743,236 (GRCm39) probably benign Het
Cyp3a57 A G 5: 145,318,090 (GRCm39) D357G probably damaging Het
Defb21 T A 2: 152,416,791 (GRCm39) L89Q possibly damaging Het
Dnah5 A T 15: 28,387,913 (GRCm39) E3124V probably benign Het
Efcab7 A G 4: 99,719,718 (GRCm39) T67A possibly damaging Het
Exo1 C T 1: 175,716,327 (GRCm39) P148L probably damaging Het
Hps4 A G 5: 112,494,527 (GRCm39) I37V probably damaging Het
Krt9 T A 11: 100,083,942 (GRCm39) M30L unknown Het
Med25 C A 7: 44,535,314 (GRCm39) R37L possibly damaging Het
Or10ak12 T G 4: 118,666,058 (GRCm39) Q318H probably benign Het
Or5an10 T C 19: 12,276,451 (GRCm39) E15G probably benign Het
Phf3 G A 1: 30,844,556 (GRCm39) Q1468* probably null Het
Phkb A G 8: 86,770,431 (GRCm39) K900R possibly damaging Het
Pirb G A 7: 3,715,990 (GRCm39) H755Y probably benign Het
Polq A T 16: 36,882,699 (GRCm39) N1342I probably damaging Het
Polr2b T A 5: 77,468,284 (GRCm39) probably benign Het
Pus1 C A 5: 110,922,826 (GRCm39) M232I probably benign Het
Serpina3a C A 12: 104,082,787 (GRCm39) Q187K probably benign Het
Slit1 G A 19: 41,599,455 (GRCm39) P1032L probably benign Het
Syne1 C T 10: 4,997,573 (GRCm39) E465K probably damaging Het
Tektl1 T C 10: 78,584,336 (GRCm39) T360A probably damaging Het
Tlk2 T G 11: 105,132,417 (GRCm39) I217R possibly damaging Het
Tlr4 A G 4: 66,758,338 (GRCm39) D377G probably damaging Het
Tmtc1 T C 6: 148,146,195 (GRCm39) D866G probably damaging Het
Tubd1 T A 11: 86,446,017 (GRCm39) I219N probably benign Het
Ugt3a1 C A 15: 9,351,203 (GRCm39) P71T probably benign Het
Vmn1r64 A G 7: 5,887,535 (GRCm39) S3P probably benign Het
Other mutations in Adamts7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00547:Adamts7 APN 9 90,076,302 (GRCm39) missense possibly damaging 0.71
IGL00673:Adamts7 APN 9 90,075,714 (GRCm39) missense possibly damaging 0.78
IGL00902:Adamts7 APN 9 90,070,847 (GRCm39) critical splice donor site probably null
IGL01303:Adamts7 APN 9 90,053,787 (GRCm39) missense possibly damaging 0.46
IGL01333:Adamts7 APN 9 90,069,032 (GRCm39) missense probably damaging 1.00
IGL01431:Adamts7 APN 9 90,089,838 (GRCm39) missense possibly damaging 0.89
IGL01595:Adamts7 APN 9 90,075,359 (GRCm39) missense probably benign 0.02
IGL02728:Adamts7 APN 9 90,073,880 (GRCm39) splice site probably benign
IGL02860:Adamts7 APN 9 90,073,915 (GRCm39) missense probably benign
IGL03237:Adamts7 APN 9 90,070,717 (GRCm39) missense probably damaging 1.00
PIT4495001:Adamts7 UTSW 9 90,056,675 (GRCm39) missense probably damaging 1.00
R0044:Adamts7 UTSW 9 90,053,641 (GRCm39) missense possibly damaging 0.58
R0078:Adamts7 UTSW 9 90,061,464 (GRCm39) missense probably damaging 1.00
R0107:Adamts7 UTSW 9 90,062,773 (GRCm39) missense possibly damaging 0.82
R0122:Adamts7 UTSW 9 90,061,474 (GRCm39) missense probably damaging 1.00
R0166:Adamts7 UTSW 9 90,075,745 (GRCm39) missense probably benign 0.00
R0517:Adamts7 UTSW 9 90,081,911 (GRCm39) missense probably benign 0.01
R1442:Adamts7 UTSW 9 90,070,823 (GRCm39) missense probably damaging 0.99
R1468:Adamts7 UTSW 9 90,070,851 (GRCm39) splice site probably benign
R1554:Adamts7 UTSW 9 90,055,703 (GRCm39) missense probably damaging 1.00
R1612:Adamts7 UTSW 9 90,070,750 (GRCm39) missense possibly damaging 0.86
R1652:Adamts7 UTSW 9 90,071,697 (GRCm39) missense probably damaging 1.00
R2007:Adamts7 UTSW 9 90,059,909 (GRCm39) missense probably damaging 1.00
R2091:Adamts7 UTSW 9 90,070,493 (GRCm39) critical splice donor site probably null
R2202:Adamts7 UTSW 9 90,062,729 (GRCm39) missense probably damaging 1.00
R2204:Adamts7 UTSW 9 90,062,729 (GRCm39) missense probably damaging 1.00
R2205:Adamts7 UTSW 9 90,062,729 (GRCm39) missense probably damaging 1.00
R2409:Adamts7 UTSW 9 90,062,740 (GRCm39) missense probably damaging 1.00
R4157:Adamts7 UTSW 9 90,070,414 (GRCm39) missense probably damaging 1.00
R4210:Adamts7 UTSW 9 90,076,063 (GRCm39) missense possibly damaging 0.95
R4368:Adamts7 UTSW 9 90,077,904 (GRCm39) critical splice donor site probably null
R4533:Adamts7 UTSW 9 90,062,761 (GRCm39) missense probably damaging 1.00
R4608:Adamts7 UTSW 9 90,056,593 (GRCm39) missense probably damaging 1.00
R4623:Adamts7 UTSW 9 90,068,515 (GRCm39) missense probably benign 0.17
R4661:Adamts7 UTSW 9 90,075,383 (GRCm39) missense probably benign 0.02
R4820:Adamts7 UTSW 9 90,071,739 (GRCm39) missense possibly damaging 0.62
R4942:Adamts7 UTSW 9 90,045,364 (GRCm39) missense probably benign
R4961:Adamts7 UTSW 9 90,067,793 (GRCm39) missense probably damaging 1.00
R5064:Adamts7 UTSW 9 90,077,883 (GRCm39) missense probably damaging 1.00
R5763:Adamts7 UTSW 9 90,070,462 (GRCm39) missense probably damaging 1.00
R5921:Adamts7 UTSW 9 90,070,747 (GRCm39) missense probably benign 0.20
R6027:Adamts7 UTSW 9 90,073,078 (GRCm39) missense probably damaging 1.00
R6182:Adamts7 UTSW 9 90,074,489 (GRCm39) missense probably benign 0.01
R6306:Adamts7 UTSW 9 90,060,331 (GRCm39) critical splice donor site probably null
R6404:Adamts7 UTSW 9 90,062,509 (GRCm39) splice site probably null
R6488:Adamts7 UTSW 9 90,053,535 (GRCm39) missense probably benign 0.00
R6649:Adamts7 UTSW 9 90,073,990 (GRCm39) missense probably damaging 1.00
R6658:Adamts7 UTSW 9 90,077,353 (GRCm39) missense probably damaging 0.99
R6874:Adamts7 UTSW 9 90,070,784 (GRCm39) missense probably damaging 1.00
R6947:Adamts7 UTSW 9 90,073,857 (GRCm39) splice site probably null
R7110:Adamts7 UTSW 9 90,076,017 (GRCm39) missense possibly damaging 0.92
R7224:Adamts7 UTSW 9 90,067,868 (GRCm39) missense probably damaging 1.00
R7239:Adamts7 UTSW 9 90,068,610 (GRCm39) splice site probably null
R7519:Adamts7 UTSW 9 90,079,132 (GRCm39) missense probably benign 0.22
R7608:Adamts7 UTSW 9 90,055,826 (GRCm39) missense possibly damaging 0.68
R7635:Adamts7 UTSW 9 90,077,298 (GRCm39) missense probably damaging 1.00
R7699:Adamts7 UTSW 9 90,070,792 (GRCm39) missense probably damaging 1.00
R8519:Adamts7 UTSW 9 90,075,610 (GRCm39) nonsense probably null
R8680:Adamts7 UTSW 9 90,077,321 (GRCm39) missense probably damaging 1.00
R8743:Adamts7 UTSW 9 90,077,296 (GRCm39) missense probably damaging 0.99
R8784:Adamts7 UTSW 9 90,075,918 (GRCm39) missense probably null 0.00
R8794:Adamts7 UTSW 9 90,076,239 (GRCm39) nonsense probably null
R8851:Adamts7 UTSW 9 90,075,163 (GRCm39) missense probably benign 0.00
R9025:Adamts7 UTSW 9 90,067,848 (GRCm39) nonsense probably null
R9038:Adamts7 UTSW 9 90,056,692 (GRCm39) missense
R9101:Adamts7 UTSW 9 90,071,794 (GRCm39) critical splice donor site probably null
R9256:Adamts7 UTSW 9 90,060,218 (GRCm39) missense probably damaging 1.00
R9261:Adamts7 UTSW 9 90,075,397 (GRCm39) missense probably benign 0.01
R9385:Adamts7 UTSW 9 90,077,258 (GRCm39) nonsense probably null
R9614:Adamts7 UTSW 9 90,077,251 (GRCm39) missense probably damaging 1.00
X0028:Adamts7 UTSW 9 90,060,270 (GRCm39) missense probably benign 0.30
Predicted Primers PCR Primer
(F):5'- AGAAACCCAGGGAATACTGC -3'
(R):5'- TGAGGCACCACATCTATCAGG -3'

Sequencing Primer
(F):5'- TCAAGGTCATGCAGCCATTG -3'
(R):5'- ACATCTATCAGGTGCCGCC -3'
Posted On 2014-10-30