Incidental Mutation 'R2305:Krt9'
ID244566
Institutional Source Beutler Lab
Gene Symbol Krt9
Ensembl Gene ENSMUSG00000051617
Gene Namekeratin 9
SynonymsKrt1-9, K9
MMRRC Submission 040304-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2305 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location100186781-100193246 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 100193116 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 30 (M30L)
Ref Sequence ENSEMBL: ENSMUSP00000055255 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059707]
Predicted Effect unknown
Transcript: ENSMUST00000059707
AA Change: M30L
SMART Domains Protein: ENSMUSP00000055255
Gene: ENSMUSG00000051617
AA Change: M30L

DomainStartEndE-ValueType
low complexity region 6 125 N/A INTRINSIC
Filament 130 442 2.96e-124 SMART
low complexity region 462 716 N/A INTRINSIC
low complexity region 721 737 N/A INTRINSIC
Meta Mutation Damage Score 0.0208 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 94.8%
Validation Efficiency 100% (32/32)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit hyperpigmented calluses on the footpad with acanthosis, hyperkeratosis, thick epidermis and increased keratinocyte proliferation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acvr1c C A 2: 58,281,699 D295Y probably damaging Het
Adamts7 A G 9: 90,180,711 D406G probably benign Het
Ankhd1 T C 18: 36,642,926 S1443P possibly damaging Het
Casp8ap2 A T 4: 32,646,411 K1828I probably damaging Het
Ccdc105 T C 10: 78,748,502 T360A probably damaging Het
Cep135 T C 5: 76,595,389 probably benign Het
Cyp3a57 A G 5: 145,381,280 D357G probably damaging Het
Defb21 T A 2: 152,574,871 L89Q possibly damaging Het
Dnah5 A T 15: 28,387,767 E3124V probably benign Het
Efcab7 A G 4: 99,831,481 T67A possibly damaging Het
Exo1 C T 1: 175,888,761 P148L probably damaging Het
Hps4 A G 5: 112,346,661 I37V probably damaging Het
Med25 C A 7: 44,885,890 R37L possibly damaging Het
Olfr1335 T G 4: 118,808,861 Q318H probably benign Het
Olfr1436 T C 19: 12,299,087 E15G probably benign Het
Phf3 G A 1: 30,805,475 Q1468* probably null Het
Phkb A G 8: 86,043,802 K900R possibly damaging Het
Pirb G A 7: 3,712,991 H755Y probably benign Het
Polq A T 16: 37,062,337 N1342I probably damaging Het
Polr2b T A 5: 77,320,437 probably benign Het
Pus1 C A 5: 110,774,960 M232I probably benign Het
Serpina3a C A 12: 104,116,528 Q187K probably benign Het
Slit1 G A 19: 41,611,016 P1032L probably benign Het
Syne1 C T 10: 5,047,573 E465K probably damaging Het
Tlk2 T G 11: 105,241,591 I217R possibly damaging Het
Tlr4 A G 4: 66,840,101 D377G probably damaging Het
Tmtc1 T C 6: 148,244,697 D866G probably damaging Het
Tubd1 T A 11: 86,555,191 I219N probably benign Het
Ugt3a2 C A 15: 9,351,117 P71T probably benign Het
Vmn1r64 A G 7: 5,884,536 S3P probably benign Het
Other mutations in Krt9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00725:Krt9 APN 11 100190006 missense probably damaging 1.00
IGL01695:Krt9 APN 11 100191437 critical splice donor site probably null
IGL02383:Krt9 APN 11 100191215 missense probably damaging 1.00
IGL02529:Krt9 APN 11 100189966 missense probably damaging 0.99
IGL02819:Krt9 APN 11 100191520 missense probably damaging 1.00
R1356:Krt9 UTSW 11 100188814 small insertion probably benign
R1397:Krt9 UTSW 11 100192638 missense probably damaging 1.00
R1498:Krt9 UTSW 11 100188369 nonsense probably null
R1772:Krt9 UTSW 11 100191305 missense probably damaging 0.99
R1871:Krt9 UTSW 11 100190788 missense probably damaging 1.00
R1883:Krt9 UTSW 11 100188697 missense unknown
R1985:Krt9 UTSW 11 100189991 missense probably benign 0.02
R2056:Krt9 UTSW 11 100191495 missense probably damaging 1.00
R2253:Krt9 UTSW 11 100190859 missense possibly damaging 0.83
R2875:Krt9 UTSW 11 100189205 nonsense probably null
R3813:Krt9 UTSW 11 100189677 missense probably damaging 1.00
R3874:Krt9 UTSW 11 100190849 missense probably damaging 1.00
R4157:Krt9 UTSW 11 100188649 missense unknown
R4762:Krt9 UTSW 11 100190849 missense probably damaging 1.00
R4873:Krt9 UTSW 11 100190037 missense probably benign 0.06
R4875:Krt9 UTSW 11 100190037 missense probably benign 0.06
R4923:Krt9 UTSW 11 100189077 small deletion probably benign
R4973:Krt9 UTSW 11 100188712 missense unknown
R5153:Krt9 UTSW 11 100191242 missense probably damaging 0.99
R5658:Krt9 UTSW 11 100190767 missense probably damaging 0.98
R5696:Krt9 UTSW 11 100189077 small deletion probably benign
R5944:Krt9 UTSW 11 100188439 missense unknown
R6147:Krt9 UTSW 11 100188839 missense unknown
R6403:Krt9 UTSW 11 100189659 missense probably damaging 0.99
R6476:Krt9 UTSW 11 100190814 missense probably damaging 1.00
R6822:Krt9 UTSW 11 100189077 small deletion probably benign
R7159:Krt9 UTSW 11 100189077 small deletion probably benign
R7174:Krt9 UTSW 11 100189077 small deletion probably benign
R7203:Krt9 UTSW 11 100190791 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCGCTGTAACTCCCTGTAC -3'
(R):5'- AGACCTTCTCTGAGTCTATGGGG -3'

Sequencing Primer
(F):5'- CGCTGTAACTCCCTGTACTAAAAC -3'
(R):5'- TGAGGACACACCCAGGCTTG -3'
Posted On2014-10-30