Incidental Mutation 'R0278:Zfp212'
ID24460
Institutional Source Beutler Lab
Gene Symbol Zfp212
Ensembl Gene ENSMUSG00000052763
Gene NameZinc finger protein 212
SynonymsZnf212
MMRRC Submission 038500-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R0278 (G1)
Quality Score213
Status Not validated
Chromosome6
Chromosomal Location47920476-47932639 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 47926519 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 13 (R13W)
Ref Sequence ENSEMBL: ENSMUSP00000009411 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009411]
Predicted Effect probably damaging
Transcript: ENSMUST00000009411
AA Change: R13W

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000009411
Gene: ENSMUSG00000052763
AA Change: R13W

DomainStartEndE-ValueType
low complexity region 10 28 N/A INTRINSIC
Pfam:DUF3669 41 111 8.1e-10 PFAM
KRAB 141 202 6.08e-5 SMART
ZnF_C2H2 313 335 4.54e-4 SMART
ZnF_C2H2 366 388 6.57e-1 SMART
ZnF_C2H2 424 446 3.21e-4 SMART
ZnF_C2H2 452 474 4.54e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156500
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 95.4%
  • 20x: 90.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the C2H2-type zinc finger gene family. The zinc finger proteins are involved in gene regulation and development, and are quite conserved throughout evolution. Like this gene product, a third of the zinc finger proteins containing C2H2 fingers also contain the KRAB domain, which has been found to be involved in protein-protein interactions. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,378,215 S3429R probably damaging Het
Abca3 A G 17: 24,381,920 D436G probably benign Het
Acacb C A 5: 114,233,259 Y1816* probably null Het
Acer3 T C 7: 98,261,597 Y86C probably damaging Het
Adgre1 A G 17: 57,447,872 I657V probably benign Het
Akap1 A G 11: 88,845,194 V214A probably benign Het
Ankrd42 T C 7: 92,631,657 R22G possibly damaging Het
Apc2 C T 10: 80,312,813 P1234S possibly damaging Het
Atp13a4 A G 16: 29,454,834 I441T probably damaging Het
Cenpu G A 8: 46,578,309 A242T probably damaging Het
Col6a6 A T 9: 105,767,288 V1267E possibly damaging Het
Crhr2 T C 6: 55,117,531 T58A probably benign Het
Ddx6 T G 9: 44,631,425 C385G probably damaging Het
Dnah7a A T 1: 53,504,146 N2288K probably benign Het
Egfl8 A T 17: 34,614,368 probably null Het
Elmo2 A T 2: 165,297,367 I420N probably damaging Het
Elovl4 A G 9: 83,783,195 F113L probably benign Het
Fancd2 T A 6: 113,548,448 probably null Het
Fbxl13 A G 5: 21,523,910 V456A probably benign Het
Fgfr2 A T 7: 130,261,862 probably null Het
Fkbpl A T 17: 34,645,410 R51* probably null Het
Fn3krp G A 11: 121,421,580 V40M probably damaging Het
Fnip1 A G 11: 54,489,343 probably null Het
Gm15446 A T 5: 109,943,415 Q511L probably benign Het
Gm7334 A G 17: 50,699,261 K192E probably damaging Het
H2-Q10 A T 17: 35,473,307 T282S possibly damaging Het
Hspa9 A G 18: 34,940,910 V482A possibly damaging Het
Ica1l A T 1: 60,013,996 S128T probably benign Het
Il7r A T 15: 9,516,337 I126K probably damaging Het
Kcnj8 T C 6: 142,570,348 E11G probably benign Het
Klkb1 A C 8: 45,272,409 F498V probably benign Het
Lama1 A G 17: 67,810,183 E2491G probably null Het
Lhfpl2 T C 13: 94,174,435 V71A probably benign Het
Lin9 T C 1: 180,665,923 I198T probably damaging Het
Lrrc7 T A 3: 158,179,795 M431L possibly damaging Het
Nmt2 A G 2: 3,325,387 T519A probably benign Het
Olfr1043 A T 2: 86,162,579 Y123* probably null Het
Olfr1247 A T 2: 89,609,763 L113Q probably damaging Het
Olfr1247 G T 2: 89,609,764 L113M probably damaging Het
Olfr1490 C A 19: 13,654,764 L112I probably damaging Het
Olfr1490 T A 19: 13,654,765 L112H probably damaging Het
Olfr412 T C 11: 74,365,202 F178L probably damaging Het
Olfr871 G T 9: 20,212,886 C179F probably damaging Het
Parp4 A G 14: 56,607,523 R624G probably damaging Het
Pex16 C T 2: 92,381,056 P325S probably damaging Het
Pik3ca T C 3: 32,439,753 M288T possibly damaging Het
Pla2g5 C T 4: 138,800,656 D100N probably benign Het
Prss43 T A 9: 110,827,362 M39K probably benign Het
Psd4 T C 2: 24,394,438 S105P probably damaging Het
Ptprz1 T A 6: 23,000,817 S969T probably benign Het
Rad23b T A 4: 55,383,575 probably null Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rpl10l A G 12: 66,284,356 M1T probably null Het
Sec16a A G 2: 26,428,316 S1588P probably damaging Het
Sh3rf1 A T 8: 61,374,018 H602L probably damaging Het
Sparcl1 A T 5: 104,088,397 S497T probably benign Het
Spata13 A G 14: 60,692,088 Y365C probably benign Het
Trim5 T C 7: 104,279,675 N20D probably benign Het
Vmn1r201 G T 13: 22,475,024 W136L probably damaging Het
Vmn2r112 A G 17: 22,603,006 I222V probably benign Het
Vmn2r56 A T 7: 12,715,717 V198D probably damaging Het
Wapl A G 14: 34,692,612 D477G possibly damaging Het
Zfp202 C A 9: 40,208,482 H194N probably benign Het
Other mutations in Zfp212
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00819:Zfp212 APN 6 47931322 missense probably damaging 0.98
IGL03357:Zfp212 APN 6 47930837 missense probably benign 0.28
R0122:Zfp212 UTSW 6 47931023 missense possibly damaging 0.87
R0219:Zfp212 UTSW 6 47926685 missense probably damaging 1.00
R1845:Zfp212 UTSW 6 47931541 missense probably benign
R4910:Zfp212 UTSW 6 47931499 missense possibly damaging 0.94
R4991:Zfp212 UTSW 6 47926862 missense probably damaging 1.00
R5297:Zfp212 UTSW 6 47929077 missense probably benign
R6074:Zfp212 UTSW 6 47927052 nonsense probably null
R6369:Zfp212 UTSW 6 47930897 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- GGTTTCTGTTGCTGCTATGAAAGTCCT -3'
(R):5'- AGCCAGCTTCTTCTCCGCTGA -3'

Sequencing Primer
(F):5'- aacacaatcaaacagggcag -3'
(R):5'- CTCCGCTGACCCTGCAC -3'
Posted On2013-04-16