Incidental Mutation 'R2307:St6galnac2'
ID244646
Institutional Source Beutler Lab
Gene Symbol St6galnac2
Ensembl Gene ENSMUSG00000110170
Gene NameST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 2
SynonymsSiat7b, ST6GalNAc II, Siat7
MMRRC Submission 040306-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.126) question?
Stock #R2307 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location116677483-116681290 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 116681905 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 242 (A242T)
Ref Sequence ENSEMBL: ENSMUSP00000078501 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079545] [ENSMUST00000144398]
Predicted Effect probably damaging
Transcript: ENSMUST00000079545
AA Change: A242T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000078501
Gene: ENSMUSG00000057286
AA Change: A242T

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:Glyco_transf_29 90 373 2.9e-66 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123236
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129236
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135771
Predicted Effect probably benign
Transcript: ENSMUST00000144398
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ST6GALNAC2 belongs to a family of sialyltransferases that add sialic acids to the nonreducing ends of glycoconjugates. At the cell surface, these modifications have roles in cell-cell and cell-substrate interactions, bacterial adhesion, and protein targeting (Samyn-Petit et al., 2000 [PubMed 10742600]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knockout allele exhibit decreased body weight, decreased IgQ, increased B cell proliferation, increased pre-B cell number, abnormal erythropoiesis, increased ALT, decreased creatinine level and prominent spleen germinal center. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008L16Rik T C 12: 55,304,316 F137L probably damaging Het
Acot5 T C 12: 84,075,601 F320L possibly damaging Het
Alox12e T C 11: 70,321,261 K170R probably damaging Het
Ano2 T C 6: 125,992,886 S722P probably benign Het
Cep192 A G 18: 67,813,899 Y215C probably benign Het
Ces2g A G 8: 104,968,412 N555S probably benign Het
Cfap58 C T 19: 47,962,486 Q429* probably null Het
Clcnkb A G 4: 141,412,329 S121P probably damaging Het
Cltb T A 13: 54,598,751 E67D probably damaging Het
Ddhd1 A T 14: 45,608,990 L581Q probably damaging Het
Dnajc3 T C 14: 118,953,221 probably null Het
Fgf14 T A 14: 123,983,822 N190I probably damaging Het
Galnt17 T G 5: 130,900,622 Y449S probably damaging Het
Grin3a C T 4: 49,793,033 probably null Het
Gxylt2 A G 6: 100,787,212 N286S probably damaging Het
H2-K1 A G 17: 33,997,139 V120A probably benign Het
Inpp5f T C 7: 128,694,310 V168A probably damaging Het
Kif1a G T 1: 93,078,769 H59N probably damaging Het
Krt24 T C 11: 99,284,630 Q193R possibly damaging Het
Krtap5-4 C A 7: 142,303,614 S7* probably null Het
Ltn1 A G 16: 87,432,424 probably null Het
Mcm2 G A 6: 88,893,008 R60C probably damaging Het
Mep1b A T 18: 21,088,575 D194V probably damaging Het
Orc3 C T 4: 34,586,503 V382M probably damaging Het
Pclo T A 5: 14,678,651 probably benign Het
Pcolce T C 5: 137,609,094 H45R probably damaging Het
Prf1 T C 10: 61,303,163 V300A possibly damaging Het
Prss53 T C 7: 127,890,865 I18V probably benign Het
Rnase2b A G 14: 51,162,731 T90A probably benign Het
Rpap1 G A 2: 119,783,766 P50L probably benign Het
Rrnad1 A T 3: 87,926,855 M171K possibly damaging Het
Rsf1 CG CGACGGCGGGG 7: 97,579,908 probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sec16b G A 1: 157,535,492 V298I probably damaging Het
Smarcd3 C T 5: 24,595,748 R156Q probably damaging Het
Syce1l T C 8: 113,643,305 probably null Het
Tcam1 T C 11: 106,284,114 C132R probably damaging Het
Trpa1 T C 1: 14,912,381 I84V probably benign Het
Ttn G A 2: 76,886,998 R455* probably null Het
Ubl5 T A 9: 20,646,580 probably benign Het
Ubr2 T A 17: 46,966,215 K779* probably null Het
Ugt1a10 A G 1: 88,055,947 I156V probably benign Het
Unc13b A G 4: 43,239,854 T3513A probably damaging Het
Vmn1r20 C T 6: 57,432,136 T149I probably benign Het
Zfp804a T A 2: 82,256,857 D343E probably benign Het
Other mutations in St6galnac2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01714:St6galnac2 APN 11 116685119 missense probably damaging 1.00
IGL01726:St6galnac2 APN 11 116685119 missense probably damaging 1.00
IGL01727:St6galnac2 APN 11 116685119 missense probably damaging 1.00
IGL01733:St6galnac2 APN 11 116685119 missense probably damaging 1.00
IGL03353:St6galnac2 APN 11 116690302 splice site probably benign
R1521:St6galnac2 UTSW 11 116684347 missense possibly damaging 0.79
R1524:St6galnac2 UTSW 11 116684487 unclassified probably benign
R1855:St6galnac2 UTSW 11 116690315 missense probably benign 0.02
R4079:St6galnac2 UTSW 11 116681898 missense possibly damaging 0.69
R4658:St6galnac2 UTSW 11 116684525 unclassified probably benign
R5174:St6galnac2 UTSW 11 116681947 missense probably damaging 0.99
R5436:St6galnac2 UTSW 11 116684527 unclassified probably benign
R5655:St6galnac2 UTSW 11 116685146 missense probably damaging 1.00
R6584:St6galnac2 UTSW 11 116694504 missense probably benign 0.06
R6702:St6galnac2 UTSW 11 116684387 missense probably benign 0.38
R6703:St6galnac2 UTSW 11 116684387 missense probably benign 0.38
R7090:St6galnac2 UTSW 11 116677635 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAACTTCTCGTGCCGTAGCC -3'
(R):5'- GGAATGGGGATCATGTGTCACC -3'

Sequencing Primer
(F):5'- CATGGGTCCTCAGAACA -3'
(R):5'- GGGACATTAAAGTTCTGTGAGCCTAC -3'
Posted On2014-10-30