Incidental Mutation 'R2307:1110008L16Rik'
ID244647
Institutional Source Beutler Lab
Gene Symbol 1110008L16Rik
Ensembl Gene ENSMUSG00000021023
Gene NameRIKEN cDNA 1110008L16 gene
Synonyms
MMRRC Submission 040306-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.653) question?
Stock #R2307 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location55299577-55382533 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 55304316 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 137 (F137L)
Ref Sequence ENSEMBL: ENSMUSP00000139252 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021410] [ENSMUST00000021411] [ENSMUST00000183475] [ENSMUST00000183654] [ENSMUST00000184766] [ENSMUST00000184980]
Predicted Effect probably benign
Transcript: ENSMUST00000021410
SMART Domains Protein: ENSMUSP00000021410
Gene: ENSMUSG00000021022

DomainStartEndE-ValueType
PDB:4I5K|B 188 437 1e-25 PDB
SCOP:d1dgua_ 258 413 4e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000021411
AA Change: F137L

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000021411
Gene: ENSMUSG00000021023
AA Change: F137L

DomainStartEndE-ValueType
Pfam:PRORP 339 575 4.8e-106 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000183475
AA Change: F137L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000139252
Gene: ENSMUSG00000021023
AA Change: F137L

DomainStartEndE-ValueType
low complexity region 410 424 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183654
SMART Domains Protein: ENSMUSP00000138821
Gene: ENSMUSG00000021023

DomainStartEndE-ValueType
Pfam:RNase_Zc3h12a 33 185 8e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184249
Predicted Effect probably damaging
Transcript: ENSMUST00000184766
AA Change: F137L

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000139204
Gene: ENSMUSG00000021023
AA Change: F137L

DomainStartEndE-ValueType
PDB:4G26|A 153 581 1e-9 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000184980
SMART Domains Protein: ENSMUSP00000139123
Gene: ENSMUSG00000021023

DomainStartEndE-ValueType
low complexity region 113 127 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218116
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 93.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot5 T C 12: 84,075,601 F320L possibly damaging Het
Alox12e T C 11: 70,321,261 K170R probably damaging Het
Ano2 T C 6: 125,992,886 S722P probably benign Het
Cep192 A G 18: 67,813,899 Y215C probably benign Het
Ces2g A G 8: 104,968,412 N555S probably benign Het
Cfap58 C T 19: 47,962,486 Q429* probably null Het
Clcnkb A G 4: 141,412,329 S121P probably damaging Het
Cltb T A 13: 54,598,751 E67D probably damaging Het
Ddhd1 A T 14: 45,608,990 L581Q probably damaging Het
Dnajc3 T C 14: 118,953,221 probably null Het
Fgf14 T A 14: 123,983,822 N190I probably damaging Het
Galnt17 T G 5: 130,900,622 Y449S probably damaging Het
Grin3a C T 4: 49,793,033 probably null Het
Gxylt2 A G 6: 100,787,212 N286S probably damaging Het
H2-K1 A G 17: 33,997,139 V120A probably benign Het
Inpp5f T C 7: 128,694,310 V168A probably damaging Het
Kif1a G T 1: 93,078,769 H59N probably damaging Het
Krt24 T C 11: 99,284,630 Q193R possibly damaging Het
Krtap5-4 C A 7: 142,303,614 S7* probably null Het
Ltn1 A G 16: 87,432,424 probably null Het
Mcm2 G A 6: 88,893,008 R60C probably damaging Het
Mep1b A T 18: 21,088,575 D194V probably damaging Het
Orc3 C T 4: 34,586,503 V382M probably damaging Het
Pclo T A 5: 14,678,651 probably benign Het
Pcolce T C 5: 137,609,094 H45R probably damaging Het
Prf1 T C 10: 61,303,163 V300A possibly damaging Het
Prss53 T C 7: 127,890,865 I18V probably benign Het
Rnase2b A G 14: 51,162,731 T90A probably benign Het
Rpap1 G A 2: 119,783,766 P50L probably benign Het
Rrnad1 A T 3: 87,926,855 M171K possibly damaging Het
Rsf1 CG CGACGGCGGGG 7: 97,579,908 probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sec16b G A 1: 157,535,492 V298I probably damaging Het
Smarcd3 C T 5: 24,595,748 R156Q probably damaging Het
St6galnac2 C T 11: 116,681,905 A242T probably damaging Het
Syce1l T C 8: 113,643,305 probably null Het
Tcam1 T C 11: 106,284,114 C132R probably damaging Het
Trpa1 T C 1: 14,912,381 I84V probably benign Het
Ttn G A 2: 76,886,998 R455* probably null Het
Ubl5 T A 9: 20,646,580 probably benign Het
Ubr2 T A 17: 46,966,215 K779* probably null Het
Ugt1a10 A G 1: 88,055,947 I156V probably benign Het
Unc13b A G 4: 43,239,854 T3513A probably damaging Het
Vmn1r20 C T 6: 57,432,136 T149I probably benign Het
Zfp804a T A 2: 82,256,857 D343E probably benign Het
Other mutations in 1110008L16Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01701:1110008L16Rik APN 12 55308875 splice site probably benign
IGL01932:1110008L16Rik APN 12 55304125 missense probably benign
IGL03030:1110008L16Rik APN 12 55304644 missense probably damaging 1.00
R0102:1110008L16Rik UTSW 12 55382297 missense probably benign 0.37
R0892:1110008L16Rik UTSW 12 55382248 splice site probably null
R1479:1110008L16Rik UTSW 12 55379387 missense probably damaging 1.00
R1510:1110008L16Rik UTSW 12 55304212 missense probably benign 0.21
R1845:1110008L16Rik UTSW 12 55304332 missense possibly damaging 0.58
R1992:1110008L16Rik UTSW 12 55338206 missense probably damaging 1.00
R4080:1110008L16Rik UTSW 12 55304613 missense possibly damaging 0.88
R4081:1110008L16Rik UTSW 12 55304613 missense possibly damaging 0.88
R4082:1110008L16Rik UTSW 12 55304613 missense possibly damaging 0.88
R5205:1110008L16Rik UTSW 12 55304441 nonsense probably null
R5590:1110008L16Rik UTSW 12 55304472 missense possibly damaging 0.89
R5940:1110008L16Rik UTSW 12 55304874 missense probably damaging 1.00
R5988:1110008L16Rik UTSW 12 55377217 missense probably damaging 1.00
R6147:1110008L16Rik UTSW 12 55379308 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTCATTACTTCGCTGCTGGAG -3'
(R):5'- TCCCCGGATGAGAAGGGTATAAC -3'

Sequencing Primer
(F):5'- GCAGCTAAGAAGAGGTCCCAC -3'
(R):5'- CAGATTCTAAACTCTTGTACTTGGC -3'
Posted On2014-10-30