Incidental Mutation 'R2307:Mep1b'
ID244661
Institutional Source Beutler Lab
Gene Symbol Mep1b
Ensembl Gene ENSMUSG00000024313
Gene Namemeprin 1 beta
SynonymsMep-1b, meprin beta
MMRRC Submission 040306-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.107) question?
Stock #R2307 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location21072344-21100199 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 21088575 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 194 (D194V)
Ref Sequence ENSEMBL: ENSMUSP00000080866 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082235]
Predicted Effect probably damaging
Transcript: ENSMUST00000082235
AA Change: D194V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000080866
Gene: ENSMUSG00000024313
AA Change: D194V

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 30 42 N/A INTRINSIC
ZnMc 68 208 1.23e-54 SMART
MAM 261 430 1.91e-52 SMART
MATH 433 569 4.88e-8 SMART
EGF 610 647 2.35e-2 SMART
transmembrane domain 658 680 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Meprins are multidomain zinc metalloproteases that are highly expressed in mammalian kidney and intestinal brush border membranes, and in leukocytes and certain cancer cells. They are involved in the hydrolysis of a variety of peptide and protein substrates, and have been implicated in cancer and intestinal inflammation. Mature meprins are oligomers of evolutionarily related, but separately encoded alpha and/or beta subunits. Homooligomers of alpha subunit are secreted, whereas, oligomers containing the beta subunit are plasma membrane-bound. This gene encodes the beta subunit. Targeted disruption of this gene in mice affects embryonic viability, renal gene expression profiles, and distribution of the membrane-associated alpha subunit in kidney and intestine. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit 50% prenatal lethality; survivors have reduced birth weight and show altered renal gene expression, but otherwise are apparently normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008L16Rik T C 12: 55,304,316 F137L probably damaging Het
Acot5 T C 12: 84,075,601 F320L possibly damaging Het
Alox12e T C 11: 70,321,261 K170R probably damaging Het
Ano2 T C 6: 125,992,886 S722P probably benign Het
Cep192 A G 18: 67,813,899 Y215C probably benign Het
Ces2g A G 8: 104,968,412 N555S probably benign Het
Cfap58 C T 19: 47,962,486 Q429* probably null Het
Clcnkb A G 4: 141,412,329 S121P probably damaging Het
Cltb T A 13: 54,598,751 E67D probably damaging Het
Ddhd1 A T 14: 45,608,990 L581Q probably damaging Het
Dnajc3 T C 14: 118,953,221 probably null Het
Fgf14 T A 14: 123,983,822 N190I probably damaging Het
Galnt17 T G 5: 130,900,622 Y449S probably damaging Het
Grin3a C T 4: 49,793,033 probably null Het
Gxylt2 A G 6: 100,787,212 N286S probably damaging Het
H2-K1 A G 17: 33,997,139 V120A probably benign Het
Inpp5f T C 7: 128,694,310 V168A probably damaging Het
Kif1a G T 1: 93,078,769 H59N probably damaging Het
Krt24 T C 11: 99,284,630 Q193R possibly damaging Het
Krtap5-4 C A 7: 142,303,614 S7* probably null Het
Ltn1 A G 16: 87,432,424 probably null Het
Mcm2 G A 6: 88,893,008 R60C probably damaging Het
Orc3 C T 4: 34,586,503 V382M probably damaging Het
Pclo T A 5: 14,678,651 probably benign Het
Pcolce T C 5: 137,609,094 H45R probably damaging Het
Prf1 T C 10: 61,303,163 V300A possibly damaging Het
Prss53 T C 7: 127,890,865 I18V probably benign Het
Rnase2b A G 14: 51,162,731 T90A probably benign Het
Rpap1 G A 2: 119,783,766 P50L probably benign Het
Rrnad1 A T 3: 87,926,855 M171K possibly damaging Het
Rsf1 CG CGACGGCGGGG 7: 97,579,908 probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sec16b G A 1: 157,535,492 V298I probably damaging Het
Smarcd3 C T 5: 24,595,748 R156Q probably damaging Het
St6galnac2 C T 11: 116,681,905 A242T probably damaging Het
Syce1l T C 8: 113,643,305 probably null Het
Tcam1 T C 11: 106,284,114 C132R probably damaging Het
Trpa1 T C 1: 14,912,381 I84V probably benign Het
Ttn G A 2: 76,886,998 R455* probably null Het
Ubl5 T A 9: 20,646,580 probably benign Het
Ubr2 T A 17: 46,966,215 K779* probably null Het
Ugt1a10 A G 1: 88,055,947 I156V probably benign Het
Unc13b A G 4: 43,239,854 T3513A probably damaging Het
Vmn1r20 C T 6: 57,432,136 T149I probably benign Het
Zfp804a T A 2: 82,256,857 D343E probably benign Het
Other mutations in Mep1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Mep1b APN 18 21084186 nonsense probably null
IGL01470:Mep1b APN 18 21097467 missense probably benign 0.26
IGL01866:Mep1b APN 18 21094993 missense probably benign 0.34
IGL02865:Mep1b APN 18 21093384 missense probably benign 0.02
IGL03093:Mep1b APN 18 21093653 missense probably benign 0.01
IGL03126:Mep1b APN 18 21088560 missense probably damaging 1.00
IGL03196:Mep1b APN 18 21095064 missense probably benign 0.01
P0022:Mep1b UTSW 18 21088541 splice site probably benign
R0143:Mep1b UTSW 18 21095107 splice site probably benign
R0743:Mep1b UTSW 18 21080458 missense possibly damaging 0.81
R0961:Mep1b UTSW 18 21088729 nonsense probably null
R1913:Mep1b UTSW 18 21093229 missense probably benign 0.21
R2162:Mep1b UTSW 18 21086239 missense possibly damaging 0.82
R3000:Mep1b UTSW 18 21093304 missense probably damaging 0.96
R3833:Mep1b UTSW 18 21086239 missense possibly damaging 0.82
R3862:Mep1b UTSW 18 21084169 missense possibly damaging 0.56
R3863:Mep1b UTSW 18 21084169 missense possibly damaging 0.56
R3864:Mep1b UTSW 18 21084169 missense possibly damaging 0.56
R4171:Mep1b UTSW 18 21095106 splice site probably null
R4774:Mep1b UTSW 18 21086184 missense probably benign 0.24
R4798:Mep1b UTSW 18 21093254 missense probably damaging 0.99
R5411:Mep1b UTSW 18 21086249 missense probably damaging 1.00
R6952:Mep1b UTSW 18 21088670 missense probably benign 0.00
R7056:Mep1b UTSW 18 21091190 missense probably damaging 1.00
R7078:Mep1b UTSW 18 21100051 missense probably benign 0.35
R7217:Mep1b UTSW 18 21093543 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGACTGCCTGGAAGTGAAGG -3'
(R):5'- TAGCTTCAGAAGGTCATAGTCAC -3'

Sequencing Primer
(F):5'- CTGTGTGTGATATCAGGTTCAAAGAC -3'
(R):5'- GGTCATAGTCACTGAAGTCCATTCG -3'
Posted On2014-10-30