Incidental Mutation 'R2308:Exoc4'
ID244674
Institutional Source Beutler Lab
Gene Symbol Exoc4
Ensembl Gene ENSMUSG00000029763
Gene Nameexocyst complex component 4
SynonymsSec8l1, Sec8
MMRRC Submission 040307-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2308 (G1)
Quality Score167
Status Not validated
Chromosome6
Chromosomal Location33249085-33973979 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 33918568 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 840 (Y840C)
Ref Sequence ENSEMBL: ENSMUSP00000051965 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052266]
Predicted Effect probably damaging
Transcript: ENSMUST00000052266
AA Change: Y840C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000051965
Gene: ENSMUSG00000029763
AA Change: Y840C

DomainStartEndE-ValueType
Pfam:Sec8_exocyst 28 144 2.4e-21 PFAM
low complexity region 338 346 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of the exocyst complex, a multiple protein complex essential for targeting exocytic vesicles to specific docking sites on the plasma membrane. Though best characterized in yeast, the component proteins and functions of exocyst complex have been demonstrated to be highly conserved in higher eukaryotes. At least eight components of the exocyst complex, including this protein, are found to interact with the actin cytoskeletal remodeling and vesicle transport machinery. The complex is also essential for the biogenesis of epithelial cell surface polarity. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display embryonic abnormatlities. Gastrulation is not completed and mesoderm formation is abnormal. Death occurs before E10.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Depdc1b G A 13: 108,373,841 V296I possibly damaging Het
Dot1l T C 10: 80,789,069 S907P probably damaging Het
Epha7 G A 4: 28,821,503 E223K possibly damaging Het
Ercc6 T C 14: 32,566,409 I846T possibly damaging Het
Gramd1a T C 7: 31,139,790 D231G probably damaging Het
Mark2 A C 19: 7,281,934 S90A probably damaging Het
Mbd1 A G 18: 74,276,477 Q432R probably benign Het
Mcm2 G A 6: 88,893,008 R60C probably damaging Het
Met T C 6: 17,491,742 S168P probably benign Het
Nup210 T C 6: 91,040,868 I304V probably benign Het
Olfr1197 T A 2: 88,729,084 I172F probably damaging Het
Olfr356 T A 2: 36,937,300 Y60* probably null Het
Ppfia4 A G 1: 134,332,397 S43P possibly damaging Het
Rbbp8 A T 18: 11,696,776 K132I possibly damaging Het
Rpap1 G A 2: 119,783,766 P50L probably benign Het
Slc41a3 T A 6: 90,612,120 I71K possibly damaging Het
Spaca7 A T 8: 12,598,959 N127I probably benign Het
Stkld1 A T 2: 26,952,714 D566V probably damaging Het
Tbxas1 A G 6: 39,027,661 M281V probably benign Het
Txnl1 T C 18: 63,671,620 T268A probably benign Het
Unc80 A T 1: 66,648,997 I2385F possibly damaging Het
Vmn2r118 A G 17: 55,624,650 I8T probably benign Het
Vmn2r80 T C 10: 79,171,621 F477S probably damaging Het
Ythdc2 A G 18: 44,847,748 E470G possibly damaging Het
Zfp352 A G 4: 90,225,243 K540R probably benign Het
Other mutations in Exoc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Exoc4 APN 6 33918399 critical splice acceptor site probably null
IGL00433:Exoc4 APN 6 33296788 missense probably damaging 1.00
IGL00833:Exoc4 APN 6 33971924 missense probably damaging 1.00
IGL01339:Exoc4 APN 6 33305400 splice site probably benign
IGL01559:Exoc4 APN 6 33266076 missense probably damaging 0.96
IGL01812:Exoc4 APN 6 33757959 splice site probably benign
IGL01926:Exoc4 APN 6 33862142 missense probably damaging 1.00
IGL02270:Exoc4 APN 6 33580026 missense possibly damaging 0.61
IGL02316:Exoc4 APN 6 33910584 missense probably damaging 0.98
IGL02332:Exoc4 APN 6 33249240 critical splice donor site probably null
IGL02668:Exoc4 APN 6 33921532 missense probably benign 0.00
slacker UTSW 6 33758098 missense probably damaging 1.00
R0049:Exoc4 UTSW 6 33296922 splice site probably null
R0134:Exoc4 UTSW 6 33971946 missense possibly damaging 0.56
R0234:Exoc4 UTSW 6 33862087 missense possibly damaging 0.89
R0234:Exoc4 UTSW 6 33862087 missense possibly damaging 0.89
R0538:Exoc4 UTSW 6 33972063 missense probably benign 0.09
R1033:Exoc4 UTSW 6 33265987 missense probably damaging 1.00
R1067:Exoc4 UTSW 6 33918424 missense possibly damaging 0.87
R1109:Exoc4 UTSW 6 33442016 missense probably damaging 1.00
R1768:Exoc4 UTSW 6 33758050 missense probably damaging 1.00
R2013:Exoc4 UTSW 6 33266091 missense probably damaging 0.96
R2078:Exoc4 UTSW 6 33910587 missense probably benign 0.06
R2114:Exoc4 UTSW 6 33347825 missense possibly damaging 0.74
R2115:Exoc4 UTSW 6 33347825 missense possibly damaging 0.74
R2117:Exoc4 UTSW 6 33347825 missense possibly damaging 0.74
R2133:Exoc4 UTSW 6 33758158 missense probably benign 0.00
R2133:Exoc4 UTSW 6 33910538 missense probably benign
R3412:Exoc4 UTSW 6 33265975 missense probably damaging 1.00
R3794:Exoc4 UTSW 6 33475997 missense probably benign
R3885:Exoc4 UTSW 6 33266131 critical splice donor site probably null
R4378:Exoc4 UTSW 6 33815687 missense probably damaging 1.00
R4534:Exoc4 UTSW 6 33277244 missense probably damaging 1.00
R4535:Exoc4 UTSW 6 33277244 missense probably damaging 1.00
R4536:Exoc4 UTSW 6 33277244 missense probably damaging 1.00
R4611:Exoc4 UTSW 6 33438405 missense possibly damaging 0.77
R4617:Exoc4 UTSW 6 33862204 missense probably benign 0.00
R4771:Exoc4 UTSW 6 33441949 critical splice acceptor site probably null
R4851:Exoc4 UTSW 6 33918408 missense probably damaging 0.96
R4921:Exoc4 UTSW 6 33910517 missense probably benign
R5358:Exoc4 UTSW 6 33265999 missense probably damaging 1.00
R5767:Exoc4 UTSW 6 33918432 missense probably benign
R6014:Exoc4 UTSW 6 33475997 missense probably benign
R6132:Exoc4 UTSW 6 33758098 missense probably damaging 1.00
R6164:Exoc4 UTSW 6 33332283 missense probably damaging 0.99
R6583:Exoc4 UTSW 6 33815753 missense probably damaging 1.00
R6915:Exoc4 UTSW 6 33921453 missense possibly damaging 0.81
R6973:Exoc4 UTSW 6 33580030 missense probably damaging 1.00
R7112:Exoc4 UTSW 6 33921488 missense probably damaging 1.00
R7129:Exoc4 UTSW 6 33971999 missense probably damaging 1.00
R7133:Exoc4 UTSW 6 33438473 missense probably benign 0.07
X0066:Exoc4 UTSW 6 33815690 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGGCCGCTTCAAATATTTCGG -3'
(R):5'- CTACCCATACAGAAAGCTAGGTG -3'

Sequencing Primer
(F):5'- AAATATTTCGGTGCTCTTTCCCAGG -3'
(R):5'- AGGTGCAGCAGTTCTAATCC -3'
Posted On2014-10-30