Mutagenetix > Incidental Mutation

Incidental Mutation 'R2322:Brinp3'

244767

Institutional Source

Beutler Lab

Gene Symbol

Brinp3

Ensembl Gene

ENSMUSG00000035131

Gene Name

bone morphogenetic protein/retinoic acid inducible neural specific 3

Synonyms

Fam5c, B830045N13Rik

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.216) question?

Stock #

R2322 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

146371367-146778210 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 146577492 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 176 (T176A)

Ref Sequence

ENSEMBL: ENSMUSP00000126074 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000074622] [ENSMUST00000128345] [ENSMUST00000132847] [ENSMUST00000166814]

AlphaFold

Q499E0

Predicted Effect

probably benign
Transcript: ENSMUST00000074622
AA Change: T176A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000074201
Gene: ENSMUSG00000035131
AA Change: T176A

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC
MACPF	78	264	7.69e-42	SMART
low complexity region	315	326	N/A	INTRINSIC
coiled coil region	349	372	N/A	INTRINSIC
EGF	440	475	1.73e1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000128345

SMART Domains

Protein: ENSMUSP00000116763
Gene: ENSMUSG00000035131

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000132847
AA Change: T176A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000118552
Gene: ENSMUSG00000035131
AA Change: T176A

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC
Blast:MACPF	78	110	1e-16	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000166814
AA Change: T176A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000126074
Gene: ENSMUSG00000035131
AA Change: T176A

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC
MACPF	78	264	7.69e-42	SMART
low complexity region	315	326	N/A	INTRINSIC
coiled coil region	349	372	N/A	INTRINSIC
EGF	440	475	1.73e1	SMART

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is overexpressed in pituitary tumors but is underexpressed in tongue squamous cell carcinomas, ulcerative colitis, and peri-implantitis. Polymorphisms that increase expression of this gene have been shown to increase vascular inflammation, and an association of this gene with myocardial infarction has been demonstrated. Finally, hypermethylation of this gene may find usefulness as a biomarker for gastric cancer. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2015]

Allele List at MGI

Other mutations in this stock

Total: 21 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A2ml1	C	T	6: 128,557,349 (GRCm39)	A115T	probably benign	Het
AY358078	A	G	14: 52,042,147 (GRCm39)	Y174C	unknown	Het
Bod1l	A	T	5: 41,984,463 (GRCm39)	V529E	probably benign	Het
Ccn2	T	C	10: 24,472,732 (GRCm39)	M214T	probably damaging	Het
Cfap57	T	A	4: 118,467,922 (GRCm39)	I272L	probably benign	Het
Cnr1	A	G	4: 33,944,514 (GRCm39)	K301E	probably damaging	Het
Elavl1	A	T	8: 4,339,802 (GRCm39)	L260H	probably damaging	Het
Ercc6	A	G	14: 32,248,274 (GRCm39)	Y275C	probably damaging	Het
Fndc1	A	G	17: 8,007,847 (GRCm39)	S96P	probably damaging	Het
Hykk	G	A	9: 54,853,418 (GRCm39)	G247S	probably benign	Het
Ky	T	C	9: 102,414,990 (GRCm39)		probably null	Het
Mcu	A	C	10: 59,290,766 (GRCm39)		probably null	Het
Or2y17	T	G	11: 49,231,476 (GRCm39)	L39R	probably damaging	Het
Or5w11	T	C	2: 87,459,118 (GRCm39)	C104R	possibly damaging	Het
Ppp4r3a	C	T	12: 101,008,878 (GRCm39)	R667Q	probably damaging	Het
Ptprj	T	C	2: 90,301,473 (GRCm39)	T220A	probably benign	Het
St18	T	A	1: 6,914,348 (GRCm39)	C766*	probably null	Het
St8sia4	C	T	1: 95,581,463 (GRCm39)	R93H	probably damaging	Het
Tcim	G	C	8: 24,928,726 (GRCm39)	R63G	probably damaging	Het
Xylb	T	C	9: 119,217,813 (GRCm39)	S488P	possibly damaging	Het
Zhx3	T	C	2: 160,623,948 (GRCm39)	D73G	probably damaging	Het

Other mutations in Brinp3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00467:Brinp3	APN	1	146,777,512 (GRCm39)	missense	probably damaging	0.99
IGL00503:Brinp3	APN	1	146,776,905 (GRCm39)	missense	probably benign
IGL01702:Brinp3	APN	1	146,627,735 (GRCm39)	splice site	probably benign
IGL01728:Brinp3	APN	1	146,707,289 (GRCm39)	splice site	probably null
IGL01733:Brinp3	APN	1	146,390,541 (GRCm39)	missense	probably benign	0.33
IGL01937:Brinp3	APN	1	146,776,878 (GRCm39)	missense	probably benign
IGL02020:Brinp3	APN	1	146,777,865 (GRCm39)	utr 3 prime	probably benign
IGL02082:Brinp3	APN	1	146,627,600 (GRCm39)	missense	probably damaging	1.00
IGL02365:Brinp3	APN	1	146,776,860 (GRCm39)	missense	probably benign	0.00
IGL02366:Brinp3	APN	1	146,577,481 (GRCm39)	missense	possibly damaging	0.84
IGL02565:Brinp3	APN	1	146,777,770 (GRCm39)	missense	probably damaging	0.98
IGL02999:Brinp3	APN	1	146,577,587 (GRCm39)	splice site	probably null
IGL03099:Brinp3	APN	1	146,777,835 (GRCm39)	missense	possibly damaging	0.91
PIT4283001:Brinp3	UTSW	1	146,777,161 (GRCm39)	missense	probably damaging	0.99
PIT4418001:Brinp3	UTSW	1	146,777,161 (GRCm39)	missense	probably damaging	0.99
R0021:Brinp3	UTSW	1	146,777,189 (GRCm39)	missense	probably benign	0.04
R0021:Brinp3	UTSW	1	146,777,189 (GRCm39)	missense	probably benign	0.04
R0266:Brinp3	UTSW	1	146,558,418 (GRCm39)	nonsense	probably null
R1468:Brinp3	UTSW	1	146,777,700 (GRCm39)	missense	probably benign	0.01
R1468:Brinp3	UTSW	1	146,777,700 (GRCm39)	missense	probably benign	0.01
R1522:Brinp3	UTSW	1	146,777,628 (GRCm39)	missense	probably damaging	0.99
R1596:Brinp3	UTSW	1	146,390,520 (GRCm39)	missense	probably benign
R1898:Brinp3	UTSW	1	146,776,987 (GRCm39)	missense	possibly damaging	0.93
R2036:Brinp3	UTSW	1	146,577,579 (GRCm39)	missense	possibly damaging	0.84
R2224:Brinp3	UTSW	1	146,777,658 (GRCm39)	nonsense	probably null
R2272:Brinp3	UTSW	1	146,777,142 (GRCm39)	missense	possibly damaging	0.93
R2291:Brinp3	UTSW	1	146,776,812 (GRCm39)	missense	possibly damaging	0.85
R2880:Brinp3	UTSW	1	146,777,740 (GRCm39)	missense	probably damaging	0.98
R3918:Brinp3	UTSW	1	146,627,599 (GRCm39)	missense	probably damaging	0.99
R3939:Brinp3	UTSW	1	146,627,599 (GRCm39)	missense	probably damaging	0.99
R3940:Brinp3	UTSW	1	146,627,599 (GRCm39)	missense	probably damaging	0.99
R3941:Brinp3	UTSW	1	146,627,599 (GRCm39)	missense	probably damaging	0.99
R3942:Brinp3	UTSW	1	146,627,599 (GRCm39)	missense	probably damaging	0.99
R4095:Brinp3	UTSW	1	146,777,430 (GRCm39)	missense	possibly damaging	0.72
R4783:Brinp3	UTSW	1	146,603,378 (GRCm39)	intron	probably benign
R5009:Brinp3	UTSW	1	146,776,787 (GRCm39)	missense	probably benign	0.25
R5034:Brinp3	UTSW	1	146,603,458 (GRCm39)	intron	probably benign
R5166:Brinp3	UTSW	1	146,777,105 (GRCm39)	missense	probably damaging	0.96
R5372:Brinp3	UTSW	1	146,707,464 (GRCm39)	missense	probably damaging	1.00
R5472:Brinp3	UTSW	1	146,777,197 (GRCm39)	missense	possibly damaging	0.86
R5651:Brinp3	UTSW	1	146,577,537 (GRCm39)	missense	probably benign	0.01
R5681:Brinp3	UTSW	1	146,777,484 (GRCm39)	missense	probably benign	0.12
R6351:Brinp3	UTSW	1	146,777,323 (GRCm39)	missense	probably damaging	0.96
R6470:Brinp3	UTSW	1	146,777,644 (GRCm39)	missense	probably damaging	0.99
R6499:Brinp3	UTSW	1	146,777,431 (GRCm39)	missense	possibly damaging	0.86
R7078:Brinp3	UTSW	1	146,390,627 (GRCm39)	nonsense	probably null
R7223:Brinp3	UTSW	1	146,776,812 (GRCm39)	missense	possibly damaging	0.85
R7322:Brinp3	UTSW	1	146,558,426 (GRCm39)	nonsense	probably null
R7347:Brinp3	UTSW	1	146,777,824 (GRCm39)	missense	probably benign	0.22
R7375:Brinp3	UTSW	1	146,777,748 (GRCm39)	missense	possibly damaging	0.91
R7412:Brinp3	UTSW	1	146,777,748 (GRCm39)	missense	possibly damaging	0.91
R7532:Brinp3	UTSW	1	146,777,139 (GRCm39)	missense	probably damaging	0.98
R7562:Brinp3	UTSW	1	146,777,748 (GRCm39)	missense	possibly damaging	0.91
R7576:Brinp3	UTSW	1	146,777,301 (GRCm39)	missense	probably damaging	0.99
R7723:Brinp3	UTSW	1	146,577,409 (GRCm39)	missense	probably damaging	1.00
R7737:Brinp3	UTSW	1	146,558,332 (GRCm39)	missense	probably damaging	0.98
R7793:Brinp3	UTSW	1	146,622,306 (GRCm39)	missense	probably benign	0.20
R8334:Brinp3	UTSW	1	146,777,791 (GRCm39)	missense	probably damaging	0.99
R8401:Brinp3	UTSW	1	146,777,184 (GRCm39)	missense	probably benign	0.17
R9205:Brinp3	UTSW	1	146,777,827 (GRCm39)	missense	possibly damaging	0.57
R9328:Brinp3	UTSW	1	146,707,455 (GRCm39)	missense	probably damaging	0.98
R9602:Brinp3	UTSW	1	146,622,234 (GRCm39)	missense	probably damaging	1.00
X0060:Brinp3	UTSW	1	146,777,524 (GRCm39)	missense	probably benign	0.01
Z1176:Brinp3	UTSW	1	146,777,814 (GRCm39)	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- GGCACTCTTTCTTGGCGATAAG -3'
(R):5'- TCAAGAGACTTGAGGCTCCAG -3'

Sequencing Primer
(F):5'- CACTCTTTCTTGGCGATAAGTATAAG -3'
(R):5'- CTTGAGGCTCCAGGGAAGG -3'

Posted On

2014-10-30