Incidental Mutation 'R2322:Ctgf'
ID244782
Institutional Source Beutler Lab
Gene Symbol Ctgf
Ensembl Gene ENSMUSG00000019997
Gene Nameconnective tissue growth factor
SynonymsHcs24, Ccn2, Fisp12, hypertrophic chondrocyte-specific gene product 24
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2322 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location24595442-24598683 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 24596834 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 214 (M214T)
Ref Sequence ENSEMBL: ENSMUSP00000135147 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020171] [ENSMUST00000129142] [ENSMUST00000176228]
Predicted Effect possibly damaging
Transcript: ENSMUST00000020171
AA Change: M214T

PolyPhen 2 Score 0.903 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000020171
Gene: ENSMUSG00000019997
AA Change: M214T

DomainStartEndE-ValueType
IB 26 96 1.45e-25 SMART
VWC 102 165 8.52e-22 SMART
TSP1 199 242 7.27e-7 SMART
CT 260 329 1.17e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125158
Predicted Effect probably benign
Transcript: ENSMUST00000129142
SMART Domains Protein: ENSMUSP00000135212
Gene: ENSMUSG00000019997

DomainStartEndE-ValueType
IB 3 73 1.45e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136908
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141076
Predicted Effect probably damaging
Transcript: ENSMUST00000176228
AA Change: M214T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000135147
Gene: ENSMUSG00000019997
AA Change: M214T

DomainStartEndE-ValueType
IB 26 96 1.45e-25 SMART
VWC 102 165 8.52e-22 SMART
TSP1 199 242 7.27e-7 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a mitogen that is secreted by vascular endothelial cells. The encoded protein plays a role in chondrocyte proliferation and differentiation, cell adhesion in many cell types, and is related to platelet-derived growth factor. Certain polymorphisms in this gene have been linked with a higher incidence of systemic sclerosis. [provided by RefSeq, Nov 2009]
PHENOTYPE: Homozygous null mice die at birth from respiratory failure due to axial skeletal defects and pulmonary hypoplasia associated with reduced cell proliferation, enhanced apoptosis and altered pneumocyte maturation. Osteogenesis is impaired due to impaired chondrogenesis and growth plate angiogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 C T 6: 128,580,386 A115T probably benign Het
AY358078 A G 14: 51,804,690 Y174C unknown Het
Bod1l A T 5: 41,827,120 V529E probably benign Het
Brinp3 A G 1: 146,701,754 T176A probably benign Het
Cfap57 T A 4: 118,610,725 I272L probably benign Het
Cnr1 A G 4: 33,944,514 K301E probably damaging Het
Elavl1 A T 8: 4,289,802 L260H probably damaging Het
Ercc6 A G 14: 32,526,317 Y275C probably damaging Het
Fndc1 A G 17: 7,789,015 S96P probably damaging Het
Hykk G A 9: 54,946,134 G247S probably benign Het
Ky T C 9: 102,537,791 probably null Het
Mcu A C 10: 59,454,944 probably null Het
Olfr1131 T C 2: 87,628,774 C104R possibly damaging Het
Olfr1390 T G 11: 49,340,649 L39R probably damaging Het
Ppp4r3a C T 12: 101,042,619 R667Q probably damaging Het
Ptprj T C 2: 90,471,129 T220A probably benign Het
St18 T A 1: 6,844,124 C766* probably null Het
St8sia4 C T 1: 95,653,738 R93H probably damaging Het
Tcim G C 8: 24,438,710 R63G probably damaging Het
Xylb T C 9: 119,388,747 S488P possibly damaging Het
Zhx3 T C 2: 160,782,028 D73G probably damaging Het
Other mutations in Ctgf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02027:Ctgf APN 10 24596409 missense probably damaging 1.00
IGL02994:Ctgf APN 10 24596865 missense probably damaging 1.00
PIT4131001:Ctgf UTSW 10 24596090 missense probably damaging 0.97
R0443:Ctgf UTSW 10 24595803 splice site probably benign
R0496:Ctgf UTSW 10 24597515 missense possibly damaging 0.51
R0538:Ctgf UTSW 10 24596466 missense probably damaging 1.00
R1599:Ctgf UTSW 10 24597399 missense probably benign 0.08
R1721:Ctgf UTSW 10 24596797 missense probably damaging 1.00
R2095:Ctgf UTSW 10 24596479 missense probably benign 0.41
R2230:Ctgf UTSW 10 24596473 missense possibly damaging 0.61
R4913:Ctgf UTSW 10 24597327 missense probably damaging 1.00
R5697:Ctgf UTSW 10 24597456 missense probably benign
R6705:Ctgf UTSW 10 24595955 missense probably damaging 0.99
R7067:Ctgf UTSW 10 24596975 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- ATTCTCCCCAACTTCAGGGC -3'
(R):5'- CCTCTAATAACATGGGAGGTGAGAC -3'

Sequencing Primer
(F):5'- TCCCCAACTTCAGGGCCAATG -3'
(R):5'- AGACAGCCAGCTCGGTTCTC -3'
Posted On2014-10-30