Incidental Mutation 'R2323:Tulp1'
ID244827
Institutional Source Beutler Lab
Gene Symbol Tulp1
Ensembl Gene ENSMUSG00000037446
Gene Nametubby like protein 1
SynonymsTulp1l
MMRRC Submission 040314-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.506) question?
Stock #R2323 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location28351515-28365182 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 28362482 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 239 (G239D)
Ref Sequence ENSEMBL: ENSMUSP00000110442 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041819] [ENSMUST00000114794] [ENSMUST00000123797] [ENSMUST00000129375]
Predicted Effect probably damaging
Transcript: ENSMUST00000041819
AA Change: G239D

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000049070
Gene: ENSMUSG00000037446
AA Change: G239D

DomainStartEndE-ValueType
internal_repeat_1 17 65 8.47e-7 PROSPERO
low complexity region 111 142 N/A INTRINSIC
low complexity region 144 158 N/A INTRINSIC
internal_repeat_1 160 212 8.47e-7 PROSPERO
coiled coil region 242 266 N/A INTRINSIC
Pfam:Tub 299 537 1.8e-82 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000114794
AA Change: G239D

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000110442
Gene: ENSMUSG00000037446
AA Change: G239D

DomainStartEndE-ValueType
internal_repeat_1 17 65 8.5e-7 PROSPERO
low complexity region 111 142 N/A INTRINSIC
low complexity region 144 158 N/A INTRINSIC
internal_repeat_1 160 212 8.5e-7 PROSPERO
coiled coil region 242 266 N/A INTRINSIC
Pfam:Tub 299 449 3.4e-59 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123797
SMART Domains Protein: ENSMUSP00000116588
Gene: ENSMUSG00000037446

DomainStartEndE-ValueType
Pfam:Tub 21 228 2.1e-88 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125876
Predicted Effect probably benign
Transcript: ENSMUST00000129375
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131604
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140250
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146493
Predicted Effect probably benign
Transcript: ENSMUST00000148188
SMART Domains Protein: ENSMUSP00000116844
Gene: ENSMUSG00000037446

DomainStartEndE-ValueType
Pfam:Tub 5 214 8.8e-76 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150341
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tubby-like gene family (TULPs). Members of this family have been identified in plants, vertebrates, and invertebrates. TULP proteins share a conserved C-terminal region of approximately 200 amino acid residues. The protein encoded by this gene is thought to play a role in the physiology of photoreceptors. Mutations in this gene are associated with recessive juvenile retinitis pigmentosa and Leber congenital amaurosis-15. [provided by RefSeq, Nov 2016]
PHENOTYPE: Homozygous mutant mice exhibit retinal degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830473C10Rik T A 5: 90,584,852 Y507* probably null Het
Abca2 G T 2: 25,445,175 M2008I probably benign Het
Adgrv1 A G 13: 81,595,179 S68P probably damaging Het
Anks3 T C 16: 4,950,770 probably null Het
Asap2 T C 12: 21,203,968 I160T probably damaging Het
Asb15 T A 6: 24,556,601 F32I probably benign Het
Catip A T 1: 74,363,278 M103L probably benign Het
Cela2a G C 4: 141,826,079 probably benign Het
Crebrf T C 17: 26,763,607 probably benign Het
Dnah10 T C 5: 124,742,000 M450T probably damaging Het
Dst T C 1: 34,228,437 S5165P possibly damaging Het
Esrp2 T A 8: 106,134,302 D196V probably benign Het
Hmox2 A T 16: 4,765,856 K263* probably null Het
Ints10 A G 8: 68,819,345 H566R probably benign Het
Ints12 G A 3: 133,109,365 M444I possibly damaging Het
Liph A G 16: 21,984,004 V105A probably damaging Het
Myo1e T A 9: 70,378,758 Y941* probably null Het
Myo7b T C 18: 31,971,345 E1450G probably damaging Het
Myt1 G T 2: 181,806,557 A594S probably damaging Het
Npas3 T A 12: 54,068,346 Y666N probably damaging Het
Npsr1 A G 9: 24,300,436 K240E probably damaging Het
Olfr652 T C 7: 104,564,619 F133L probably benign Het
Rtkn2 A G 10: 68,001,934 I102M probably damaging Het
Rundc1 T C 11: 101,425,275 F58L probably damaging Het
Snrpc T G 17: 27,847,974 M91R unknown Het
Tgfbr2 T C 9: 116,110,144 K205R possibly damaging Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Tnfrsf21 C A 17: 43,085,529 S568* probably null Het
Vmn1r234 T C 17: 21,229,703 I293T probably benign Het
Vmn1r26 T C 6: 58,008,857 K116E probably damaging Het
Vmn2r98 T A 17: 19,065,819 I193K probably benign Het
Wnk4 T A 11: 101,268,481 S575T probably damaging Het
Zfp558 A T 9: 18,469,277 probably null Het
Zscan18 T C 7: 12,775,459 probably benign Het
Other mutations in Tulp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01952:Tulp1 APN 17 28356424 missense probably damaging 1.00
IGL01955:Tulp1 APN 17 28356424 missense probably damaging 1.00
IGL02388:Tulp1 APN 17 28358659 missense probably damaging 1.00
IGL02511:Tulp1 APN 17 28356168 missense probably benign 0.15
IGL02973:Tulp1 APN 17 28358542 splice site probably benign
IGL03054:Tulp1 APN 17 28359313 unclassified probably benign
IGL03248:Tulp1 APN 17 28359324 missense possibly damaging 0.87
R1017:Tulp1 UTSW 17 28364303 missense probably damaging 1.00
R1543:Tulp1 UTSW 17 28362671 unclassified probably benign
R1593:Tulp1 UTSW 17 28362701 missense probably damaging 0.97
R1826:Tulp1 UTSW 17 28356367 missense possibly damaging 0.89
R3840:Tulp1 UTSW 17 28353715 missense probably damaging 1.00
R3841:Tulp1 UTSW 17 28353715 missense probably damaging 1.00
R3930:Tulp1 UTSW 17 28353709 missense probably damaging 1.00
R4690:Tulp1 UTSW 17 28351837 unclassified probably benign
R4823:Tulp1 UTSW 17 28353572 missense probably benign 0.01
R4916:Tulp1 UTSW 17 28359135 missense probably damaging 1.00
R5024:Tulp1 UTSW 17 28351995 nonsense probably null
R5159:Tulp1 UTSW 17 28359060 critical splice donor site probably null
R5249:Tulp1 UTSW 17 28362677 unclassified probably benign
R5567:Tulp1 UTSW 17 28359198 missense possibly damaging 0.47
R6072:Tulp1 UTSW 17 28363784 missense possibly damaging 0.71
R6127:Tulp1 UTSW 17 28356150 missense probably benign
R6207:Tulp1 UTSW 17 28358677 unclassified probably benign
R6416:Tulp1 UTSW 17 28356031 makesense probably null
R6773:Tulp1 UTSW 17 28362902 missense probably damaging 1.00
R7242:Tulp1 UTSW 17 28363405 intron probably null
R7323:Tulp1 UTSW 17 28356424 missense probably damaging 1.00
X0024:Tulp1 UTSW 17 28353697 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATGTGCCCTGTCACAGATG -3'
(R):5'- AGCAGCCATGTTCCTGGTTG -3'

Sequencing Primer
(F):5'- AGATGGGGAGCCAAGTCCTC -3'
(R):5'- TCAAGGGTGCTGTGACCG -3'
Posted On2014-10-30