Incidental Mutation 'R2324:Piwil4'
ID244852
Institutional Source Beutler Lab
Gene Symbol Piwil4
Ensembl Gene ENSMUSG00000036912
Gene Namepiwi-like RNA-mediated gene silencing 4
SynonymsMiwi2, 9230101H05Rik, MIWI2
MMRRC Submission 040315-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.587) question?
Stock #R2324 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location14696230-14740733 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 14736908 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 125 (R125H)
Ref Sequence ENSEMBL: ENSMUSP00000076213 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076946] [ENSMUST00000115644]
Predicted Effect possibly damaging
Transcript: ENSMUST00000076946
AA Change: R125H

PolyPhen 2 Score 0.878 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000076213
Gene: ENSMUSG00000036912
AA Change: R125H

DomainStartEndE-ValueType
Pfam:ArgoN 155 300 3.7e-11 PFAM
PAZ 313 450 2.55e-67 SMART
Piwi 614 864 8.98e-95 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000115644
AA Change: R62H

PolyPhen 2 Score 0.780 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000111308
Gene: ENSMUSG00000036912
AA Change: R62H

DomainStartEndE-ValueType
Pfam:ArgoN 92 245 6.5e-10 PFAM
PAZ 266 403 2.55e-67 SMART
Piwi 541 834 6.71e-126 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000121218
Meta Mutation Damage Score 0.0656 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 100% (33/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] PIWIL4 belongs to the Argonaute family of proteins, which function in development and maintenance of germline stem cells (Sasaki et al., 2003 [PubMed 12906857]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit male specific-infertility with a progressive loss of male germ cells, reduced testis size, abnormal male meiosis and increased apoptosis of spermatocytes in seminiferous tubules. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akna T C 4: 63,371,802 D1223G possibly damaging Het
Ankrd42 C A 7: 92,623,978 R147L probably damaging Het
Apopt1 A G 12: 111,724,350 E112G possibly damaging Het
Cep152 T C 2: 125,563,462 I1717V probably benign Het
Clca3a2 A G 3: 144,806,280 probably null Het
Dnhd1 A T 7: 105,710,090 H3544L probably damaging Het
Dpy19l4 T C 4: 11,276,857 probably benign Het
Efcab8 A G 2: 153,783,809 probably null Het
Esyt2 A G 12: 116,367,821 N773S possibly damaging Het
Gm281 A T 14: 13,868,077 I204N probably damaging Het
Hectd4 G A 5: 121,315,437 G613D probably damaging Het
Ints12 G A 3: 133,109,365 M444I possibly damaging Het
Ints3 A G 3: 90,394,094 L827P probably damaging Het
Irf9 T C 14: 55,605,910 probably null Het
Lactb2 T C 1: 13,638,296 D176G probably damaging Het
Lmntd2 A T 7: 141,210,788 S516T possibly damaging Het
Lrp1 C A 10: 127,566,586 A2239S possibly damaging Het
Lrrc56 A G 7: 141,205,563 probably benign Het
Nfic A G 10: 81,406,087 probably null Het
Notch3 G A 17: 32,150,134 probably benign Het
Oas2 T C 5: 120,743,274 K251E probably benign Het
Olfr178 T C 16: 58,890,140 T27A probably benign Het
Pabpc4 T C 4: 123,297,778 probably benign Het
Rbsn A G 6: 92,193,966 Y325H probably damaging Het
Rhox2e C A X: 37,530,863 P69Q probably damaging Het
Skint6 T C 4: 112,872,457 probably null Het
Tmem165 T C 5: 76,204,824 probably benign Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Ttc13 A G 8: 124,679,057 V499A probably damaging Het
Vax2 G T 6: 83,711,325 R10L possibly damaging Het
Zfp988 A C 4: 147,332,785 K559Q probably benign Het
Other mutations in Piwil4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Piwil4 APN 9 14703097 missense probably damaging 1.00
IGL00331:Piwil4 APN 9 14715031 splice site probably benign
IGL00848:Piwil4 APN 9 14727411 missense probably damaging 0.98
IGL00920:Piwil4 APN 9 14727437 missense probably damaging 1.00
IGL01583:Piwil4 APN 9 14734487 missense probably damaging 1.00
IGL01690:Piwil4 APN 9 14703095 missense probably damaging 1.00
IGL01763:Piwil4 APN 9 14706266 unclassified probably null
IGL02103:Piwil4 APN 9 14725986 splice site probably null
IGL02898:Piwil4 APN 9 14706287 unclassified probably benign
IGL03037:Piwil4 APN 9 14705012 missense possibly damaging 0.88
IGL03352:Piwil4 APN 9 14725887 missense probably damaging 1.00
PIT4651001:Piwil4 UTSW 9 14708899 missense possibly damaging 0.48
R0453:Piwil4 UTSW 9 14727452 missense probably benign 0.00
R3236:Piwil4 UTSW 9 14700248 unclassified probably benign
R3408:Piwil4 UTSW 9 14725963 missense probably damaging 1.00
R3689:Piwil4 UTSW 9 14725963 missense probably damaging 1.00
R3844:Piwil4 UTSW 9 14729960 missense possibly damaging 0.54
R4191:Piwil4 UTSW 9 14715000 missense probably damaging 0.99
R4505:Piwil4 UTSW 9 14725963 missense probably damaging 1.00
R4506:Piwil4 UTSW 9 14725963 missense probably damaging 1.00
R4541:Piwil4 UTSW 9 14718316 missense probably damaging 1.00
R4652:Piwil4 UTSW 9 14712308 nonsense probably null
R4876:Piwil4 UTSW 9 14740465 missense probably benign 0.22
R5027:Piwil4 UTSW 9 14709944 missense probably damaging 1.00
R5479:Piwil4 UTSW 9 14705041 missense probably damaging 1.00
R6656:Piwil4 UTSW 9 14709934 missense probably damaging 1.00
R6736:Piwil4 UTSW 9 14715823 missense probably benign
R7096:Piwil4 UTSW 9 14736816 nonsense probably null
R7124:Piwil4 UTSW 9 14736900 missense probably benign
X0026:Piwil4 UTSW 9 14740591 utr 5 prime probably benign
X0064:Piwil4 UTSW 9 14708875 missense probably benign 0.00
Z1088:Piwil4 UTSW 9 14734517 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGATTAATAGCCCCTCCCC -3'
(R):5'- ATGGCACTGTAAAAGCTAACAC -3'

Sequencing Primer
(F):5'- CCCTGTGTTCTAATAAACTGCAGTGG -3'
(R):5'- TGGCACTGTAAAAGCTAACACTAAGC -3'
Posted On2014-10-30