Incidental Mutation 'R2325:Cdh9'
ID244899
Institutional Source Beutler Lab
Gene Symbol Cdh9
Ensembl Gene ENSMUSG00000025370
Gene Namecadherin 9
SynonymsT1-cadherin
MMRRC Submission 040316-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.249) question?
Stock #R2325 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location16728756-16857094 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 16778200 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 34 (R34G)
Ref Sequence ENSEMBL: ENSMUSP00000154022 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026432] [ENSMUST00000228307]
Predicted Effect probably benign
Transcript: ENSMUST00000026432
AA Change: R34G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000026432
Gene: ENSMUSG00000025370
AA Change: R34G

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
CA 75 156 2.84e-15 SMART
CA 180 265 5.63e-28 SMART
CA 289 381 1.12e-13 SMART
CA 404 485 8.03e-24 SMART
CA 508 595 1.34e-2 SMART
transmembrane domain 613 635 N/A INTRINSIC
Pfam:Cadherin_C 638 782 1.5e-54 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000228307
AA Change: R34G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type II classical cadherin from the cadherin superfamily, integral membrane proteins that mediate calcium-dependent cell-cell adhesion. Mature cadherin proteins are composed of a large N-terminal extracellular domain, a single membrane-spanning domain, and a small, highly conserved C-terminal cytoplasmic domain. The extracellular domain consists of 5 subdomains, each containing a cadherin motif, and appears to determine the specificity of the protein's homophilic cell adhesion activity. Type II (atypical) cadherins are defined based on their lack of a HAV cell adhesion recognition sequence specific to type I cadherins. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous knockout results in the formation of abnormal axonal arbors in some retinal type 5 bipolar cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akr1c20 T C 13: 4,523,296 T7A probably benign Het
Atoh7 C A 10: 63,100,145 probably benign Het
Atp2b1 C T 10: 99,018,895 Q219* probably null Het
B3galt2 A G 1: 143,647,188 D354G probably benign Het
Cyp4x1 A T 4: 115,124,379 C126S probably benign Het
Dse A T 10: 34,184,047 S21T probably benign Het
Ell2 T A 13: 75,769,626 H558Q probably damaging Het
Esco2 A T 14: 65,826,578 probably null Het
Fam170a A G 18: 50,281,850 K188E possibly damaging Het
Gin1 A C 1: 97,792,561 Y516S probably damaging Het
Gm8439 A G 4: 120,588,851 E16G unknown Het
Gtf2b A G 3: 142,780,090 T176A probably damaging Het
Ikbkap A T 4: 56,784,622 M457K probably benign Het
Kcnh6 C T 11: 106,033,835 S822F probably benign Het
Lct T C 1: 128,304,226 M629V probably damaging Het
Lrp8 A T 4: 107,864,009 D602V probably benign Het
Med12l A G 3: 59,232,454 T817A probably damaging Het
Mroh9 A C 1: 163,026,530 probably null Het
N4bp1 T C 8: 86,848,460 I736V probably damaging Het
Nebl T C 2: 17,393,016 K490E possibly damaging Het
P2ry1 A T 3: 61,003,578 K46M probably damaging Het
Ppp1r37 A T 7: 19,532,684 L426H probably damaging Het
Prkci T A 3: 31,031,068 probably null Het
Prss35 G A 9: 86,756,304 G376R probably damaging Het
Scube2 C G 7: 109,843,954 C226S probably damaging Het
Slc26a5 T G 5: 21,819,694 Y469S probably damaging Het
Stil T A 4: 115,032,707 D797E probably benign Het
Thbs2 A T 17: 14,690,289 probably null Het
Tmem132e C A 11: 82,434,515 L114M probably damaging Het
Tmem161b C A 13: 84,294,768 T269K possibly damaging Het
Vmn1r173 T A 7: 23,703,112 C257* probably null Het
Zc3h15 G A 2: 83,653,439 G53S probably damaging Het
Zfp462 A C 4: 55,013,712 I1893L probably benign Het
Other mutations in Cdh9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Cdh9 APN 15 16828362 missense probably damaging 1.00
IGL00555:Cdh9 APN 15 16823406 missense probably damaging 1.00
IGL01110:Cdh9 APN 15 16855926 missense possibly damaging 0.63
IGL01432:Cdh9 APN 15 16830947 missense probably damaging 1.00
IGL01768:Cdh9 APN 15 16778225 missense possibly damaging 0.51
IGL02043:Cdh9 APN 15 16856232 missense probably damaging 1.00
IGL02304:Cdh9 APN 15 16848601 missense probably benign 0.01
IGL02380:Cdh9 APN 15 16856000 missense possibly damaging 0.79
IGL02505:Cdh9 APN 15 16855989 missense probably damaging 1.00
IGL02675:Cdh9 APN 15 16849076 splice site probably null
IGL02679:Cdh9 APN 15 16832230 missense probably damaging 0.97
IGL03288:Cdh9 APN 15 16856049 missense probably damaging 1.00
R0426:Cdh9 UTSW 15 16823454 critical splice donor site probably null
R0726:Cdh9 UTSW 15 16831044 missense probably benign 0.00
R1335:Cdh9 UTSW 15 16850792 missense probably benign 0.00
R1368:Cdh9 UTSW 15 16848482 splice site probably benign
R1766:Cdh9 UTSW 15 16778306 missense probably damaging 1.00
R1916:Cdh9 UTSW 15 16823275 missense probably benign 0.03
R2424:Cdh9 UTSW 15 16850354 missense probably damaging 1.00
R3104:Cdh9 UTSW 15 16855814 missense probably damaging 1.00
R3837:Cdh9 UTSW 15 16823438 nonsense probably null
R3839:Cdh9 UTSW 15 16823438 nonsense probably null
R4241:Cdh9 UTSW 15 16849079 critical splice acceptor site probably null
R4248:Cdh9 UTSW 15 16850388 missense probably benign 0.00
R4576:Cdh9 UTSW 15 16832239 missense possibly damaging 0.73
R4679:Cdh9 UTSW 15 16850959 missense probably benign
R4896:Cdh9 UTSW 15 16778156 missense probably benign 0.12
R4961:Cdh9 UTSW 15 16850828 missense probably benign
R5050:Cdh9 UTSW 15 16778147 missense probably benign 0.12
R5089:Cdh9 UTSW 15 16778276 missense probably damaging 1.00
R5268:Cdh9 UTSW 15 16851013 missense probably benign
R5567:Cdh9 UTSW 15 16855844 missense probably damaging 1.00
R5646:Cdh9 UTSW 15 16823285 missense probably damaging 1.00
R5894:Cdh9 UTSW 15 16832100 missense possibly damaging 0.47
R6440:Cdh9 UTSW 15 16823423 missense probably benign 0.01
R6441:Cdh9 UTSW 15 16823423 missense probably benign 0.01
R7225:Cdh9 UTSW 15 16856073 missense probably damaging 1.00
R7247:Cdh9 UTSW 15 16778255 missense probably damaging 1.00
X0062:Cdh9 UTSW 15 16848539 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- CACTGTTGAGTGTGTATTCATTCTC -3'
(R):5'- TGGTACATTTCACACCTCTCAATGG -3'

Sequencing Primer
(F):5'- CTTCTACATTTTGCTCTACAGACTAC -3'
(R):5'- CACCTCTCAATGGAAGAATTTACAG -3'
Posted On2014-10-30