Incidental Mutation 'R2274:Sned1'
ID244936
Institutional Source Beutler Lab
Gene Symbol Sned1
Ensembl Gene ENSMUSG00000047793
Gene Namesushi, nidogen and EGF-like domains 1
Synonyms6720455I24Rik, D430044C15Rik, Snep
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R2274 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location93235841-93301065 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 93281642 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000062202] [ENSMUST00000062202] [ENSMUST00000062202] [ENSMUST00000062202]
Predicted Effect probably null
Transcript: ENSMUST00000062202
SMART Domains Protein: ENSMUSP00000050832
Gene: ENSMUSG00000047793

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
NIDO 103 260 2.98e-54 SMART
EGF 271 309 3.79e-6 SMART
EGF_CA 311 347 2.42e-13 SMART
EGF 352 385 1.02e-6 SMART
EGF_CA 387 423 1.91e-11 SMART
EGF 432 465 2.96e-8 SMART
EGF 471 500 6.02e0 SMART
EGF 544 577 3.54e-6 SMART
EGF 583 616 6.06e-5 SMART
EGF_CA 619 655 2.33e-6 SMART
EGF 660 693 1.77e-6 SMART
CCP 698 751 2.5e-11 SMART
EGF_CA 753 789 1.66e-11 SMART
EGF_CA 791 827 1.38e-8 SMART
EGF_CA 829 865 1.92e-7 SMART
EGF 870 903 2.35e-2 SMART
FN3 906 991 1.7e-4 SMART
FN3 1005 1084 1.38e-4 SMART
FN3 1104 1185 1.6e-9 SMART
EGF 1309 1342 6.16e-6 SMART
Predicted Effect probably null
Transcript: ENSMUST00000062202
SMART Domains Protein: ENSMUSP00000050832
Gene: ENSMUSG00000047793

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
NIDO 103 260 2.98e-54 SMART
EGF 271 309 3.79e-6 SMART
EGF_CA 311 347 2.42e-13 SMART
EGF 352 385 1.02e-6 SMART
EGF_CA 387 423 1.91e-11 SMART
EGF 432 465 2.96e-8 SMART
EGF 471 500 6.02e0 SMART
EGF 544 577 3.54e-6 SMART
EGF 583 616 6.06e-5 SMART
EGF_CA 619 655 2.33e-6 SMART
EGF 660 693 1.77e-6 SMART
CCP 698 751 2.5e-11 SMART
EGF_CA 753 789 1.66e-11 SMART
EGF_CA 791 827 1.38e-8 SMART
EGF_CA 829 865 1.92e-7 SMART
EGF 870 903 2.35e-2 SMART
FN3 906 991 1.7e-4 SMART
FN3 1005 1084 1.38e-4 SMART
FN3 1104 1185 1.6e-9 SMART
EGF 1309 1342 6.16e-6 SMART
Predicted Effect probably null
Transcript: ENSMUST00000062202
SMART Domains Protein: ENSMUSP00000050832
Gene: ENSMUSG00000047793

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
NIDO 103 260 2.98e-54 SMART
EGF 271 309 3.79e-6 SMART
EGF_CA 311 347 2.42e-13 SMART
EGF 352 385 1.02e-6 SMART
EGF_CA 387 423 1.91e-11 SMART
EGF 432 465 2.96e-8 SMART
EGF 471 500 6.02e0 SMART
EGF 544 577 3.54e-6 SMART
EGF 583 616 6.06e-5 SMART
EGF_CA 619 655 2.33e-6 SMART
EGF 660 693 1.77e-6 SMART
CCP 698 751 2.5e-11 SMART
EGF_CA 753 789 1.66e-11 SMART
EGF_CA 791 827 1.38e-8 SMART
EGF_CA 829 865 1.92e-7 SMART
EGF 870 903 2.35e-2 SMART
FN3 906 991 1.7e-4 SMART
FN3 1005 1084 1.38e-4 SMART
FN3 1104 1185 1.6e-9 SMART
EGF 1309 1342 6.16e-6 SMART
Predicted Effect probably null
Transcript: ENSMUST00000062202
SMART Domains Protein: ENSMUSP00000050832
Gene: ENSMUSG00000047793

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
NIDO 103 260 2.98e-54 SMART
EGF 271 309 3.79e-6 SMART
EGF_CA 311 347 2.42e-13 SMART
EGF 352 385 1.02e-6 SMART
EGF_CA 387 423 1.91e-11 SMART
EGF 432 465 2.96e-8 SMART
EGF 471 500 6.02e0 SMART
EGF 544 577 3.54e-6 SMART
EGF 583 616 6.06e-5 SMART
EGF_CA 619 655 2.33e-6 SMART
EGF 660 693 1.77e-6 SMART
CCP 698 751 2.5e-11 SMART
EGF_CA 753 789 1.66e-11 SMART
EGF_CA 791 827 1.38e-8 SMART
EGF_CA 829 865 1.92e-7 SMART
EGF 870 903 2.35e-2 SMART
FN3 906 991 1.7e-4 SMART
FN3 1005 1084 1.38e-4 SMART
FN3 1104 1185 1.6e-9 SMART
EGF 1309 1342 6.16e-6 SMART
Predicted Effect probably null
Transcript: ENSMUST00000163688
SMART Domains Protein: ENSMUSP00000132455
Gene: ENSMUSG00000047793

DomainStartEndE-ValueType
EGF_CA 1 37 6.7e-7 SMART
EGF_CA 39 75 1.92e-7 SMART
EGF 80 113 2.35e-2 SMART
FN3 116 201 1.7e-4 SMART
FN3 215 294 1.38e-4 SMART
FN3 314 395 1.6e-9 SMART
EGF 487 520 6.16e-6 SMART
Predicted Effect probably null
Transcript: ENSMUST00000163688
SMART Domains Protein: ENSMUSP00000132455
Gene: ENSMUSG00000047793

DomainStartEndE-ValueType
EGF_CA 1 37 6.7e-7 SMART
EGF_CA 39 75 1.92e-7 SMART
EGF 80 113 2.35e-2 SMART
FN3 116 201 1.7e-4 SMART
FN3 215 294 1.38e-4 SMART
FN3 314 395 1.6e-9 SMART
EGF 487 520 6.16e-6 SMART
Predicted Effect probably null
Transcript: ENSMUST00000163688
SMART Domains Protein: ENSMUSP00000132455
Gene: ENSMUSG00000047793

DomainStartEndE-ValueType
EGF_CA 1 37 6.7e-7 SMART
EGF_CA 39 75 1.92e-7 SMART
EGF 80 113 2.35e-2 SMART
FN3 116 201 1.7e-4 SMART
FN3 215 294 1.38e-4 SMART
FN3 314 395 1.6e-9 SMART
EGF 487 520 6.16e-6 SMART
Predicted Effect probably null
Transcript: ENSMUST00000163688
SMART Domains Protein: ENSMUSP00000132455
Gene: ENSMUSG00000047793

DomainStartEndE-ValueType
EGF_CA 1 37 6.7e-7 SMART
EGF_CA 39 75 1.92e-7 SMART
EGF 80 113 2.35e-2 SMART
FN3 116 201 1.7e-4 SMART
FN3 215 294 1.38e-4 SMART
FN3 314 395 1.6e-9 SMART
EGF 487 520 6.16e-6 SMART
Predicted Effect probably null
Transcript: ENSMUST00000163688
SMART Domains Protein: ENSMUSP00000132455
Gene: ENSMUSG00000047793

DomainStartEndE-ValueType
EGF_CA 1 37 6.7e-7 SMART
EGF_CA 39 75 1.92e-7 SMART
EGF 80 113 2.35e-2 SMART
FN3 116 201 1.7e-4 SMART
FN3 215 294 1.38e-4 SMART
FN3 314 395 1.6e-9 SMART
EGF 487 520 6.16e-6 SMART
Predicted Effect probably null
Transcript: ENSMUST00000163688
SMART Domains Protein: ENSMUSP00000132455
Gene: ENSMUSG00000047793

DomainStartEndE-ValueType
EGF_CA 1 37 6.7e-7 SMART
EGF_CA 39 75 1.92e-7 SMART
EGF 80 113 2.35e-2 SMART
FN3 116 201 1.7e-4 SMART
FN3 215 294 1.38e-4 SMART
FN3 314 395 1.6e-9 SMART
EGF 487 520 6.16e-6 SMART
Predicted Effect probably null
Transcript: ENSMUST00000163688
SMART Domains Protein: ENSMUSP00000132455
Gene: ENSMUSG00000047793

DomainStartEndE-ValueType
EGF_CA 1 37 6.7e-7 SMART
EGF_CA 39 75 1.92e-7 SMART
EGF 80 113 2.35e-2 SMART
FN3 116 201 1.7e-4 SMART
FN3 215 294 1.38e-4 SMART
FN3 314 395 1.6e-9 SMART
EGF 487 520 6.16e-6 SMART
Predicted Effect probably null
Transcript: ENSMUST00000163688
SMART Domains Protein: ENSMUSP00000132455
Gene: ENSMUSG00000047793

DomainStartEndE-ValueType
EGF_CA 1 37 6.7e-7 SMART
EGF_CA 39 75 1.92e-7 SMART
EGF 80 113 2.35e-2 SMART
FN3 116 201 1.7e-4 SMART
FN3 215 294 1.38e-4 SMART
FN3 314 395 1.6e-9 SMART
EGF 487 520 6.16e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165843
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172289
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300003K06Rik A T 11: 99,837,841 C59S possibly damaging Het
Abca5 A T 11: 110,275,281 N1556K possibly damaging Het
Abcb10 G T 8: 123,982,752 A21E probably benign Het
Ackr1 T C 1: 173,332,485 N156D probably benign Het
Adamtsl3 A T 7: 82,606,558 S1593C probably benign Het
Ank3 T A 10: 69,950,942 probably null Het
Aqp4 A G 18: 15,393,480 S315P probably benign Het
Atp7b T C 8: 22,020,832 I433V probably benign Het
Bco1 G A 8: 117,108,783 probably null Het
Cacna1g T A 11: 94,415,936 E1842V probably damaging Het
Calhm3 T A 19: 47,157,547 Q73L probably damaging Het
Car5a C T 8: 121,944,669 probably null Het
Cdk11b T A 4: 155,647,594 probably benign Het
Cdr2 A T 7: 120,958,509 H264Q possibly damaging Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
D7Ertd443e A G 7: 134,270,201 S644P probably damaging Het
Dnlz A T 2: 26,351,471 C82S probably damaging Het
Egr4 A T 6: 85,512,743 F112I probably damaging Het
Emilin1 C T 5: 30,917,738 P441L possibly damaging Het
F11 T C 8: 45,252,147 D119G possibly damaging Het
Fat4 T A 3: 38,995,899 V3970D possibly damaging Het
Fbxw5 C A 2: 25,504,761 C222* probably null Het
Fn1 C T 1: 71,613,943 G1296R probably null Het
Ghr A G 15: 3,320,025 V557A probably benign Het
Gm11568 A G 11: 99,858,244 S92G unknown Het
Gpatch1 A T 7: 35,288,678 S678T probably benign Het
Gpr155 A G 2: 73,348,135 probably null Het
Gucy2f A T X: 142,116,273 M697K probably benign Het
Hecw1 T C 13: 14,346,068 T195A probably benign Het
Hoxd1 A G 2: 74,764,157 K252R probably damaging Het
Iqck G A 7: 118,899,657 D173N possibly damaging Het
Irf8 A G 8: 120,753,527 E168G probably damaging Het
Kcnh1 T G 1: 192,337,521 V358G probably damaging Het
Kifap3 T A 1: 163,868,758 V652D possibly damaging Het
L3hypdh T C 12: 72,084,858 Y100C possibly damaging Het
Map4k1 T A 7: 29,001,957 H729Q probably damaging Het
March1 T A 8: 66,387,499 N311K probably benign Het
Mier2 T C 10: 79,544,534 I321V probably damaging Het
Mta1 C T 12: 113,128,150 S291L probably damaging Het
Myh2 A G 11: 67,190,358 K1267E possibly damaging Het
Nbea A T 3: 55,988,085 probably null Het
Nexmif T G X: 104,087,846 E155A possibly damaging Het
Nkpd1 A G 7: 19,523,897 I534V probably benign Het
Nxph1 G T 6: 9,247,746 C239F probably damaging Het
Odc1 A G 12: 17,548,424 I189V probably benign Het
Olfr1170 A G 2: 88,224,823 F70L probably benign Het
Olfr314 T C 11: 58,786,666 V144A probably benign Het
Olfr351 A T 2: 36,860,101 N82K probably damaging Het
Olfr781 T C 10: 129,333,457 I192T probably benign Het
Pcdhb15 T C 18: 37,475,443 L576P probably damaging Het
Raph1 T C 1: 60,498,500 D499G probably damaging Het
Rptor T A 11: 119,756,322 C246* probably null Het
Rtl1 T C 12: 109,594,667 E246G unknown Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Slc12a3 T A 8: 94,333,287 I187N possibly damaging Het
Slc46a1 T G 11: 78,466,423 S101A probably benign Het
Slc4a8 A G 15: 100,807,402 M830V probably benign Het
St3gal6 T A 16: 58,488,969 E34D possibly damaging Het
Tcstv3 C T 13: 120,317,654 Q30* probably null Het
Tex16 T A X: 112,121,141 D1112E probably damaging Het
Tmcc3 G A 10: 94,578,915 V160I probably damaging Het
Tmf1 T A 6: 97,163,586 L776F probably damaging Het
Tsr1 A T 11: 74,904,827 probably null Het
Tyrp1 A T 4: 80,837,534 E180V probably damaging Het
Ubr3 T C 2: 70,016,341 V1636A probably benign Het
Usp1 T C 4: 98,929,842 L139P probably damaging Het
Vmn1r232 A G 17: 20,914,203 L45P probably benign Het
Vmn1r49 G A 6: 90,072,144 T292I probably benign Het
Wdr19 T A 5: 65,240,991 M853K possibly damaging Het
Zkscan8 C T 13: 21,521,796 M265I probably benign Het
Other mutations in Sned1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00785:Sned1 APN 1 93274169 splice site probably benign
IGL00955:Sned1 APN 1 93274403 missense probably damaging 1.00
IGL01367:Sned1 APN 1 93283214 missense probably benign 0.32
IGL02116:Sned1 APN 1 93281725 nonsense probably null
IGL02195:Sned1 APN 1 93274160 missense probably benign 0.03
IGL02390:Sned1 APN 1 93261664 missense probably benign
IGL02423:Sned1 APN 1 93283600 missense probably benign
IGL02451:Sned1 APN 1 93236208 splice site probably benign
IGL02567:Sned1 APN 1 93274347 missense probably damaging 0.96
IGL03184:Sned1 APN 1 93274668 missense probably benign 0.01
IGL03328:Sned1 APN 1 93289367 missense probably benign
R0257:Sned1 UTSW 1 93265097 missense possibly damaging 0.75
R0372:Sned1 UTSW 1 93285951 splice site probably benign
R0525:Sned1 UTSW 1 93271974 splice site probably null
R0727:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R0759:Sned1 UTSW 1 93272564 missense probably damaging 1.00
R0965:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R0968:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R0969:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1006:Sned1 UTSW 1 93256392 missense probably damaging 1.00
R1068:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1069:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1070:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1112:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1113:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1114:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1115:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1118:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1119:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1144:Sned1 UTSW 1 93280576 missense probably damaging 0.98
R1228:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1230:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1231:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1313:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1313:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1340:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1382:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1383:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1394:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1395:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1397:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1414:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1430:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1432:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1473:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1503:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1563:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1565:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1689:Sned1 UTSW 1 93283372 missense probably damaging 0.99
R1695:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1734:Sned1 UTSW 1 93259768 missense probably damaging 1.00
R1764:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1767:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1896:Sned1 UTSW 1 93265047 missense probably benign 0.16
R1916:Sned1 UTSW 1 93274162 missense probably null 1.00
R1945:Sned1 UTSW 1 93271238 missense probably benign 0.01
R1972:Sned1 UTSW 1 93265073 missense probably damaging 1.00
R1973:Sned1 UTSW 1 93265073 missense probably damaging 1.00
R2143:Sned1 UTSW 1 93271684 missense probably damaging 1.00
R2144:Sned1 UTSW 1 93271684 missense probably damaging 1.00
R2145:Sned1 UTSW 1 93271684 missense probably damaging 1.00
R2153:Sned1 UTSW 1 93274657 missense probably benign 0.01
R2273:Sned1 UTSW 1 93281642 splice site probably null
R2275:Sned1 UTSW 1 93281642 splice site probably null
R2340:Sned1 UTSW 1 93256452 missense probably damaging 0.98
R3237:Sned1 UTSW 1 93259003 missense probably benign 0.21
R3747:Sned1 UTSW 1 93261751 missense probably damaging 1.00
R3879:Sned1 UTSW 1 93265030 splice site probably benign
R4281:Sned1 UTSW 1 93285855 nonsense probably null
R4282:Sned1 UTSW 1 93285855 nonsense probably null
R4356:Sned1 UTSW 1 93265391 splice site probably null
R4358:Sned1 UTSW 1 93274659 missense probably benign 0.01
R4677:Sned1 UTSW 1 93296297 unclassified probably benign
R5291:Sned1 UTSW 1 93295724 missense possibly damaging 0.80
R5340:Sned1 UTSW 1 93282757 missense probably benign 0.09
R5542:Sned1 UTSW 1 93271602 missense probably benign
R5582:Sned1 UTSW 1 93282361 missense probably damaging 1.00
R5874:Sned1 UTSW 1 93265345 missense probably damaging 1.00
R6159:Sned1 UTSW 1 93282937 missense probably benign 0.00
R6175:Sned1 UTSW 1 93275474 splice site probably null
R6445:Sned1 UTSW 1 93283596 missense possibly damaging 0.89
R6631:Sned1 UTSW 1 93281652 missense probably damaging 1.00
R7018:Sned1 UTSW 1 93284421 missense probably damaging 1.00
R7035:Sned1 UTSW 1 93262130 missense probably damaging 1.00
R7047:Sned1 UTSW 1 93285818 missense possibly damaging 0.51
R7347:Sned1 UTSW 1 93281736 missense probably damaging 1.00
R7427:Sned1 UTSW 1 93289358 missense probably benign 0.11
X0025:Sned1 UTSW 1 93261687 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAACTCCCAAGGCTGTGGTG -3'
(R):5'- TGAGCATGTGTTCCTGGAAG -3'

Sequencing Primer
(F):5'- AAGGCTGTGGTGACCCG -3'
(R):5'- CATGTGTTCCTGGAAGTGGAAG -3'
Posted On2014-10-30