Incidental Mutation 'R2274:Cdk11b'
ID244955
Institutional Source Beutler Lab
Gene Symbol Cdk11b
Ensembl Gene ENSMUSG00000029062
Gene Namecyclin-dependent kinase 11B
SynonymsPITSLRE proteins, CDK11-p110, Cdc2l1, Cdc2l2, CDK11-p46, CDK11-p58
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2274 (G1)
Quality Score191
Status Not validated
Chromosome4
Chromosomal Location155624854-155649938 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to A at 155647594 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000111488 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030937] [ENSMUST00000067081] [ENSMUST00000105598] [ENSMUST00000105600] [ENSMUST00000115821]
Predicted Effect probably benign
Transcript: ENSMUST00000030937
SMART Domains Protein: ENSMUSP00000030937
Gene: ENSMUSG00000029061

DomainStartEndE-ValueType
low complexity region 19 41 N/A INTRINSIC
ZnMc 85 256 8.39e-48 SMART
ShKT 255 291 4.06e-10 SMART
IG 307 390 4.53e-2 SMART
Predicted Effect unknown
Transcript: ENSMUST00000067081
AA Change: V487D
SMART Domains Protein: ENSMUSP00000070527
Gene: ENSMUSG00000029062
AA Change: V487D

DomainStartEndE-ValueType
low complexity region 19 48 N/A INTRINSIC
low complexity region 93 112 N/A INTRINSIC
coiled coil region 123 214 N/A INTRINSIC
low complexity region 252 259 N/A INTRINSIC
low complexity region 261 272 N/A INTRINSIC
coiled coil region 290 337 N/A INTRINSIC
low complexity region 369 383 N/A INTRINSIC
S_TKc 427 712 5.05e-93 SMART
Predicted Effect unknown
Transcript: ENSMUST00000105598
AA Change: V453D
SMART Domains Protein: ENSMUSP00000101223
Gene: ENSMUSG00000029062
AA Change: V453D

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 59 78 N/A INTRINSIC
coiled coil region 89 180 N/A INTRINSIC
low complexity region 218 225 N/A INTRINSIC
low complexity region 227 238 N/A INTRINSIC
coiled coil region 256 303 N/A INTRINSIC
low complexity region 335 349 N/A INTRINSIC
S_TKc 393 678 5.05e-93 SMART
Predicted Effect unknown
Transcript: ENSMUST00000105600
AA Change: V487D
SMART Domains Protein: ENSMUSP00000101225
Gene: ENSMUSG00000029062
AA Change: V487D

DomainStartEndE-ValueType
low complexity region 19 48 N/A INTRINSIC
low complexity region 93 112 N/A INTRINSIC
coiled coil region 123 214 N/A INTRINSIC
low complexity region 252 259 N/A INTRINSIC
low complexity region 261 272 N/A INTRINSIC
coiled coil region 290 337 N/A INTRINSIC
low complexity region 369 383 N/A INTRINSIC
S_TKc 427 712 5.05e-93 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115821
SMART Domains Protein: ENSMUSP00000111488
Gene: ENSMUSG00000073682

DomainStartEndE-ValueType
SCOP:d1l9ha_ 17 52 2e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130944
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139242
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143196
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155100
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156906
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the serine/threonine protein kinase family. Members of this kinase family are known to be essential for eukaryotic cell cycle control. Due to a segmental duplication, this gene shares very high sequence identity with a neighboring gene. These two genes are frequently deleted or altered in neuroblastoma. The protein kinase encoded by this gene can be cleaved by caspases and may play a role in cell apoptosis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous null embryos display embryonic lethality from cell cycle arrest. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300003K06Rik A T 11: 99,837,841 C59S possibly damaging Het
Abca5 A T 11: 110,275,281 N1556K possibly damaging Het
Abcb10 G T 8: 123,982,752 A21E probably benign Het
Ackr1 T C 1: 173,332,485 N156D probably benign Het
Adamtsl3 A T 7: 82,606,558 S1593C probably benign Het
Ank3 T A 10: 69,950,942 probably null Het
Aqp4 A G 18: 15,393,480 S315P probably benign Het
Atp7b T C 8: 22,020,832 I433V probably benign Het
Bco1 G A 8: 117,108,783 probably null Het
Cacna1g T A 11: 94,415,936 E1842V probably damaging Het
Calhm3 T A 19: 47,157,547 Q73L probably damaging Het
Car5a C T 8: 121,944,669 probably null Het
Cdr2 A T 7: 120,958,509 H264Q possibly damaging Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
D7Ertd443e A G 7: 134,270,201 S644P probably damaging Het
Dnlz A T 2: 26,351,471 C82S probably damaging Het
Egr4 A T 6: 85,512,743 F112I probably damaging Het
Emilin1 C T 5: 30,917,738 P441L possibly damaging Het
F11 T C 8: 45,252,147 D119G possibly damaging Het
Fat4 T A 3: 38,995,899 V3970D possibly damaging Het
Fbxw5 C A 2: 25,504,761 C222* probably null Het
Fn1 C T 1: 71,613,943 G1296R probably null Het
Ghr A G 15: 3,320,025 V557A probably benign Het
Gm11568 A G 11: 99,858,244 S92G unknown Het
Gpatch1 A T 7: 35,288,678 S678T probably benign Het
Gpr155 A G 2: 73,348,135 probably null Het
Gucy2f A T X: 142,116,273 M697K probably benign Het
Hecw1 T C 13: 14,346,068 T195A probably benign Het
Hoxd1 A G 2: 74,764,157 K252R probably damaging Het
Iqck G A 7: 118,899,657 D173N possibly damaging Het
Irf8 A G 8: 120,753,527 E168G probably damaging Het
Kcnh1 T G 1: 192,337,521 V358G probably damaging Het
Kifap3 T A 1: 163,868,758 V652D possibly damaging Het
L3hypdh T C 12: 72,084,858 Y100C possibly damaging Het
Map4k1 T A 7: 29,001,957 H729Q probably damaging Het
March1 T A 8: 66,387,499 N311K probably benign Het
Mier2 T C 10: 79,544,534 I321V probably damaging Het
Mta1 C T 12: 113,128,150 S291L probably damaging Het
Myh2 A G 11: 67,190,358 K1267E possibly damaging Het
Nbea A T 3: 55,988,085 probably null Het
Nexmif T G X: 104,087,846 E155A possibly damaging Het
Nkpd1 A G 7: 19,523,897 I534V probably benign Het
Nxph1 G T 6: 9,247,746 C239F probably damaging Het
Odc1 A G 12: 17,548,424 I189V probably benign Het
Olfr1170 A G 2: 88,224,823 F70L probably benign Het
Olfr314 T C 11: 58,786,666 V144A probably benign Het
Olfr351 A T 2: 36,860,101 N82K probably damaging Het
Olfr781 T C 10: 129,333,457 I192T probably benign Het
Pcdhb15 T C 18: 37,475,443 L576P probably damaging Het
Raph1 T C 1: 60,498,500 D499G probably damaging Het
Rptor T A 11: 119,756,322 C246* probably null Het
Rtl1 T C 12: 109,594,667 E246G unknown Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Slc12a3 T A 8: 94,333,287 I187N possibly damaging Het
Slc46a1 T G 11: 78,466,423 S101A probably benign Het
Slc4a8 A G 15: 100,807,402 M830V probably benign Het
Sned1 T A 1: 93,281,642 probably null Het
St3gal6 T A 16: 58,488,969 E34D possibly damaging Het
Tcstv3 C T 13: 120,317,654 Q30* probably null Het
Tex16 T A X: 112,121,141 D1112E probably damaging Het
Tmcc3 G A 10: 94,578,915 V160I probably damaging Het
Tmf1 T A 6: 97,163,586 L776F probably damaging Het
Tsr1 A T 11: 74,904,827 probably null Het
Tyrp1 A T 4: 80,837,534 E180V probably damaging Het
Ubr3 T C 2: 70,016,341 V1636A probably benign Het
Usp1 T C 4: 98,929,842 L139P probably damaging Het
Vmn1r232 A G 17: 20,914,203 L45P probably benign Het
Vmn1r49 G A 6: 90,072,144 T292I probably benign Het
Wdr19 T A 5: 65,240,991 M853K possibly damaging Het
Zkscan8 C T 13: 21,521,796 M265I probably benign Het
Other mutations in Cdk11b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01764:Cdk11b APN 4 155628803 missense possibly damaging 0.54
R0071:Cdk11b UTSW 4 155649423 unclassified probably benign
R0071:Cdk11b UTSW 4 155649423 unclassified probably benign
R0145:Cdk11b UTSW 4 155641619 intron probably benign
R0372:Cdk11b UTSW 4 155641500 intron probably benign
R0426:Cdk11b UTSW 4 155642512 intron probably benign
R0471:Cdk11b UTSW 4 155647542 unclassified probably benign
R0627:Cdk11b UTSW 4 155640772 intron probably benign
R1475:Cdk11b UTSW 4 155634217 missense probably damaging 1.00
R1611:Cdk11b UTSW 4 155641575 intron probably benign
R1719:Cdk11b UTSW 4 155648397 unclassified probably benign
R1750:Cdk11b UTSW 4 155628680 intron probably null
R2061:Cdk11b UTSW 4 155641604 intron probably benign
R2922:Cdk11b UTSW 4 155640744 intron probably benign
R3719:Cdk11b UTSW 4 155626886 missense probably damaging 1.00
R3917:Cdk11b UTSW 4 155626801 missense probably damaging 1.00
R4077:Cdk11b UTSW 4 155639747 intron probably benign
R4078:Cdk11b UTSW 4 155639747 intron probably benign
R5033:Cdk11b UTSW 4 155648825 unclassified probably benign
R5212:Cdk11b UTSW 4 155638615 intron probably null
R5556:Cdk11b UTSW 4 155634147 nonsense probably null
R5622:Cdk11b UTSW 4 155630217 missense probably damaging 1.00
R5927:Cdk11b UTSW 4 155648240 unclassified probably benign
R5975:Cdk11b UTSW 4 155648240 unclassified probably benign
R6276:Cdk11b UTSW 4 155634190 missense probably benign 0.11
R6278:Cdk11b UTSW 4 155649603 unclassified probably benign
R6905:Cdk11b UTSW 4 155641608 intron probably benign
R6998:Cdk11b UTSW 4 155648343 nonsense probably null
R7021:Cdk11b UTSW 4 155641567 intron probably benign
R7062:Cdk11b UTSW 4 155626811 missense probably damaging 1.00
R7100:Cdk11b UTSW 4 155625593 missense probably damaging 1.00
Z1088:Cdk11b UTSW 4 155641564 intron probably benign
Predicted Primers PCR Primer
(F):5'- CCTCAAACTCATGGTAAACCTCCTG -3'
(R):5'- CCCACCCTAGGAAATACTGGTTC -3'

Sequencing Primer
(F):5'- GTCTCAGCTTACATGAAAGACAGGTC -3'
(R):5'- GGTTCTTAAAAACCTGGAATCGAAG -3'
Posted On2014-10-30