Incidental Mutation 'R2274:Olfr314'
ID244986
Institutional Source Beutler Lab
Gene Symbol Olfr314
Ensembl Gene ENSMUSG00000059504
Gene Nameolfactory receptor 314
SynonymsMOR278-2, GA_x6K02T2NKPP-622179-621244
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2274 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location58782952-58788768 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 58786666 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 144 (V144A)
Ref Sequence ENSEMBL: ENSMUSP00000145387 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076393] [ENSMUST00000205189]
Predicted Effect probably benign
Transcript: ENSMUST00000076393
AA Change: V144A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000075729
Gene: ENSMUSG00000059504
AA Change: V144A

DomainStartEndE-ValueType
Pfam:7tm_4 26 306 2.8e-50 PFAM
Pfam:7TM_GPCR_Srsx 33 249 2.1e-6 PFAM
Pfam:7tm_1 39 288 2.3e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205189
AA Change: V144A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000145387
Gene: ENSMUSG00000059504
AA Change: V144A

DomainStartEndE-ValueType
Pfam:7tm_4 26 259 8.9e-42 PFAM
Pfam:7TM_GPCR_Srsx 33 246 9.4e-6 PFAM
Pfam:7tm_1 39 259 1.1e-25 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300003K06Rik A T 11: 99,837,841 C59S possibly damaging Het
Abca5 A T 11: 110,275,281 N1556K possibly damaging Het
Abcb10 G T 8: 123,982,752 A21E probably benign Het
Ackr1 T C 1: 173,332,485 N156D probably benign Het
Adamtsl3 A T 7: 82,606,558 S1593C probably benign Het
Ank3 T A 10: 69,950,942 probably null Het
Aqp4 A G 18: 15,393,480 S315P probably benign Het
Atp7b T C 8: 22,020,832 I433V probably benign Het
Bco1 G A 8: 117,108,783 probably null Het
Cacna1g T A 11: 94,415,936 E1842V probably damaging Het
Calhm3 T A 19: 47,157,547 Q73L probably damaging Het
Car5a C T 8: 121,944,669 probably null Het
Cdk11b T A 4: 155,647,594 probably benign Het
Cdr2 A T 7: 120,958,509 H264Q possibly damaging Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
D7Ertd443e A G 7: 134,270,201 S644P probably damaging Het
Dnlz A T 2: 26,351,471 C82S probably damaging Het
Egr4 A T 6: 85,512,743 F112I probably damaging Het
Emilin1 C T 5: 30,917,738 P441L possibly damaging Het
F11 T C 8: 45,252,147 D119G possibly damaging Het
Fat4 T A 3: 38,995,899 V3970D possibly damaging Het
Fbxw5 C A 2: 25,504,761 C222* probably null Het
Fn1 C T 1: 71,613,943 G1296R probably null Het
Ghr A G 15: 3,320,025 V557A probably benign Het
Gm11568 A G 11: 99,858,244 S92G unknown Het
Gpatch1 A T 7: 35,288,678 S678T probably benign Het
Gpr155 A G 2: 73,348,135 probably null Het
Gucy2f A T X: 142,116,273 M697K probably benign Het
Hecw1 T C 13: 14,346,068 T195A probably benign Het
Hoxd1 A G 2: 74,764,157 K252R probably damaging Het
Iqck G A 7: 118,899,657 D173N possibly damaging Het
Irf8 A G 8: 120,753,527 E168G probably damaging Het
Kcnh1 T G 1: 192,337,521 V358G probably damaging Het
Kifap3 T A 1: 163,868,758 V652D possibly damaging Het
L3hypdh T C 12: 72,084,858 Y100C possibly damaging Het
Map4k1 T A 7: 29,001,957 H729Q probably damaging Het
March1 T A 8: 66,387,499 N311K probably benign Het
Mier2 T C 10: 79,544,534 I321V probably damaging Het
Mta1 C T 12: 113,128,150 S291L probably damaging Het
Myh2 A G 11: 67,190,358 K1267E possibly damaging Het
Nbea A T 3: 55,988,085 probably null Het
Nexmif T G X: 104,087,846 E155A possibly damaging Het
Nkpd1 A G 7: 19,523,897 I534V probably benign Het
Nxph1 G T 6: 9,247,746 C239F probably damaging Het
Odc1 A G 12: 17,548,424 I189V probably benign Het
Olfr1170 A G 2: 88,224,823 F70L probably benign Het
Olfr351 A T 2: 36,860,101 N82K probably damaging Het
Olfr781 T C 10: 129,333,457 I192T probably benign Het
Pcdhb15 T C 18: 37,475,443 L576P probably damaging Het
Raph1 T C 1: 60,498,500 D499G probably damaging Het
Rptor T A 11: 119,756,322 C246* probably null Het
Rtl1 T C 12: 109,594,667 E246G unknown Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Slc12a3 T A 8: 94,333,287 I187N possibly damaging Het
Slc46a1 T G 11: 78,466,423 S101A probably benign Het
Slc4a8 A G 15: 100,807,402 M830V probably benign Het
Sned1 T A 1: 93,281,642 probably null Het
St3gal6 T A 16: 58,488,969 E34D possibly damaging Het
Tcstv3 C T 13: 120,317,654 Q30* probably null Het
Tex16 T A X: 112,121,141 D1112E probably damaging Het
Tmcc3 G A 10: 94,578,915 V160I probably damaging Het
Tmf1 T A 6: 97,163,586 L776F probably damaging Het
Tsr1 A T 11: 74,904,827 probably null Het
Tyrp1 A T 4: 80,837,534 E180V probably damaging Het
Ubr3 T C 2: 70,016,341 V1636A probably benign Het
Usp1 T C 4: 98,929,842 L139P probably damaging Het
Vmn1r232 A G 17: 20,914,203 L45P probably benign Het
Vmn1r49 G A 6: 90,072,144 T292I probably benign Het
Wdr19 T A 5: 65,240,991 M853K possibly damaging Het
Zkscan8 C T 13: 21,521,796 M265I probably benign Het
Other mutations in Olfr314
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02036:Olfr314 APN 11 58787097 missense probably damaging 1.00
IGL02268:Olfr314 APN 11 58786725 missense probably benign 0.39
IGL02743:Olfr314 APN 11 58786780 nonsense probably null
R0157:Olfr314 UTSW 11 58787059 missense probably damaging 1.00
R0622:Olfr314 UTSW 11 58786341 missense probably damaging 1.00
R0926:Olfr314 UTSW 11 58787109 missense probably damaging 1.00
R1985:Olfr314 UTSW 11 58786384 missense probably damaging 0.99
R2273:Olfr314 UTSW 11 58786666 missense probably benign 0.00
R5642:Olfr314 UTSW 11 58786828 missense probably damaging 1.00
R5770:Olfr314 UTSW 11 58786594 missense probably benign 0.39
R6292:Olfr314 UTSW 11 58786237 start codon destroyed probably null 0.94
R6813:Olfr314 UTSW 11 58786646 missense probably benign 0.06
R7285:Olfr314 UTSW 11 58786484 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AAGTTCATCTCTGCCGCTGG -3'
(R):5'- CCAGGATGAGACCATAGGACATC -3'

Sequencing Primer
(F):5'- CTGGCTGTGGCTTCCAGATC -3'
(R):5'- TGAGACCATAGGACATCAGGATG -3'
Posted On2014-10-30