Incidental Mutation 'R2274:Abca5'
ID244993
Institutional Source Beutler Lab
Gene Symbol Abca5
Ensembl Gene ENSMUSG00000018800
Gene NameATP-binding cassette, sub-family A (ABC1), member 5
SynonymsABC13, B930033A02Rik
Accession Numbers

NCBI RefSeq: NM_147219.2; MGI: 2386607

Is this an essential gene? Probably non essential (E-score: 0.179) question?
Stock #R2274 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location110269369-110337716 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 110275281 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 1556 (N1556K)
Ref Sequence ENSEMBL: ENSMUSP00000047927 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043961]
Predicted Effect possibly damaging
Transcript: ENSMUST00000043961
AA Change: N1556K

PolyPhen 2 Score 0.929 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000047927
Gene: ENSMUSG00000018800
AA Change: N1556K

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 29 416 4.3e-33 PFAM
AAA 506 691 2.88e-8 SMART
low complexity region 733 744 N/A INTRINSIC
transmembrane domain 864 886 N/A INTRINSIC
transmembrane domain 971 993 N/A INTRINSIC
low complexity region 1262 1267 N/A INTRINSIC
AAA 1325 1512 3.52e-3 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype Strain: 3581814
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, and White). This encoded protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. This gene is clustered among 4 other ABC1 family members on 17q24, but neither the substrate nor the function of this gene is known. Alternative splicing of this gene results in several transcript variants; however, not all variants have been fully described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit exophthalmos, tremors and collapse of the thyroid gland, and develop a dilated cardiomyopathy with large thrombi due to depression of the cardiac function. Severe edema, liver injury and premature death appear to be sensitive to genetic background. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted(3)

Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300003K06Rik A T 11: 99,837,841 C59S possibly damaging Het
Abcb10 G T 8: 123,982,752 A21E probably benign Het
Ackr1 T C 1: 173,332,485 N156D probably benign Het
Adamtsl3 A T 7: 82,606,558 S1593C probably benign Het
Ank3 T A 10: 69,950,942 probably null Het
Aqp4 A G 18: 15,393,480 S315P probably benign Het
Atp7b T C 8: 22,020,832 I433V probably benign Het
Bco1 G A 8: 117,108,783 probably null Het
Cacna1g T A 11: 94,415,936 E1842V probably damaging Het
Calhm3 T A 19: 47,157,547 Q73L probably damaging Het
Car5a C T 8: 121,944,669 probably null Het
Cdk11b T A 4: 155,647,594 probably benign Het
Cdr2 A T 7: 120,958,509 H264Q possibly damaging Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
D7Ertd443e A G 7: 134,270,201 S644P probably damaging Het
Dnlz A T 2: 26,351,471 C82S probably damaging Het
Egr4 A T 6: 85,512,743 F112I probably damaging Het
Emilin1 C T 5: 30,917,738 P441L possibly damaging Het
F11 T C 8: 45,252,147 D119G possibly damaging Het
Fat4 T A 3: 38,995,899 V3970D possibly damaging Het
Fbxw5 C A 2: 25,504,761 C222* probably null Het
Fn1 C T 1: 71,613,943 G1296R probably null Het
Ghr A G 15: 3,320,025 V557A probably benign Het
Gm11568 A G 11: 99,858,244 S92G unknown Het
Gpatch1 A T 7: 35,288,678 S678T probably benign Het
Gpr155 A G 2: 73,348,135 probably null Het
Gucy2f A T X: 142,116,273 M697K probably benign Het
Hecw1 T C 13: 14,346,068 T195A probably benign Het
Hoxd1 A G 2: 74,764,157 K252R probably damaging Het
Iqck G A 7: 118,899,657 D173N possibly damaging Het
Irf8 A G 8: 120,753,527 E168G probably damaging Het
Kcnh1 T G 1: 192,337,521 V358G probably damaging Het
Kifap3 T A 1: 163,868,758 V652D possibly damaging Het
L3hypdh T C 12: 72,084,858 Y100C possibly damaging Het
Map4k1 T A 7: 29,001,957 H729Q probably damaging Het
March1 T A 8: 66,387,499 N311K probably benign Het
Mier2 T C 10: 79,544,534 I321V probably damaging Het
Mta1 C T 12: 113,128,150 S291L probably damaging Het
Myh2 A G 11: 67,190,358 K1267E possibly damaging Het
Nbea A T 3: 55,988,085 probably null Het
Nexmif T G X: 104,087,846 E155A possibly damaging Het
Nkpd1 A G 7: 19,523,897 I534V probably benign Het
Nxph1 G T 6: 9,247,746 C239F probably damaging Het
Odc1 A G 12: 17,548,424 I189V probably benign Het
Olfr1170 A G 2: 88,224,823 F70L probably benign Het
Olfr314 T C 11: 58,786,666 V144A probably benign Het
Olfr351 A T 2: 36,860,101 N82K probably damaging Het
Olfr781 T C 10: 129,333,457 I192T probably benign Het
Pcdhb15 T C 18: 37,475,443 L576P probably damaging Het
Raph1 T C 1: 60,498,500 D499G probably damaging Het
Rptor T A 11: 119,756,322 C246* probably null Het
Rtl1 T C 12: 109,594,667 E246G unknown Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Slc12a3 T A 8: 94,333,287 I187N possibly damaging Het
Slc46a1 T G 11: 78,466,423 S101A probably benign Het
Slc4a8 A G 15: 100,807,402 M830V probably benign Het
Sned1 T A 1: 93,281,642 probably null Het
St3gal6 T A 16: 58,488,969 E34D possibly damaging Het
Tcstv3 C T 13: 120,317,654 Q30* probably null Het
Tex16 T A X: 112,121,141 D1112E probably damaging Het
Tmcc3 G A 10: 94,578,915 V160I probably damaging Het
Tmf1 T A 6: 97,163,586 L776F probably damaging Het
Tsr1 A T 11: 74,904,827 probably null Het
Tyrp1 A T 4: 80,837,534 E180V probably damaging Het
Ubr3 T C 2: 70,016,341 V1636A probably benign Het
Usp1 T C 4: 98,929,842 L139P probably damaging Het
Vmn1r232 A G 17: 20,914,203 L45P probably benign Het
Vmn1r49 G A 6: 90,072,144 T292I probably benign Het
Wdr19 T A 5: 65,240,991 M853K possibly damaging Het
Zkscan8 C T 13: 21,521,796 M265I probably benign Het
Other mutations in Abca5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00487:Abca5 APN 11 110309450 critical splice acceptor site probably null
IGL00675:Abca5 APN 11 110304985 missense probably damaging 1.00
IGL01512:Abca5 APN 11 110317823 missense probably benign 0.40
IGL01559:Abca5 APN 11 110272526 missense probably benign
IGL01584:Abca5 APN 11 110304923 missense probably damaging 0.98
IGL01604:Abca5 APN 11 110277636 missense possibly damaging 0.47
IGL01828:Abca5 APN 11 110287695 missense probably benign
IGL01880:Abca5 APN 11 110293263 missense probably benign 0.01
IGL02054:Abca5 APN 11 110292123 missense probably damaging 0.99
IGL02074:Abca5 APN 11 110293350 missense probably benign 0.00
IGL02233:Abca5 APN 11 110274344 nonsense probably null
IGL02245:Abca5 APN 11 110298169 nonsense probably null
IGL02317:Abca5 APN 11 110327761 missense probably benign 0.09
IGL02352:Abca5 APN 11 110275330 missense probably benign 0.01
IGL02359:Abca5 APN 11 110275330 missense probably benign 0.01
IGL02390:Abca5 APN 11 110296551 missense probably benign
IGL02600:Abca5 APN 11 110309438 missense probably benign 0.02
IGL02639:Abca5 APN 11 110288073 missense possibly damaging 0.79
IGL03000:Abca5 APN 11 110317814 missense probably benign 0.04
IGL03074:Abca5 APN 11 110310275 missense probably benign 0.01
IGL03078:Abca5 APN 11 110276545 nonsense probably null
IGL03342:Abca5 APN 11 110287691 missense possibly damaging 0.94
IGL03368:Abca5 APN 11 110313522 splice site probably benign
atles UTSW 11 110299929 missense probably damaging 0.99
demento UTSW 11 110310233 missense probably damaging 1.00
jones UTSW 11 110288058 splice site probably null
R0106:Abca5 UTSW 11 110319825 missense probably damaging 1.00
R0116:Abca5 UTSW 11 110276505 missense probably damaging 1.00
R0305:Abca5 UTSW 11 110273311 splice site probably benign
R0550:Abca5 UTSW 11 110293840 missense probably damaging 1.00
R0578:Abca5 UTSW 11 110276489 nonsense probably null
R0587:Abca5 UTSW 11 110311377 missense probably benign 0.00
R0610:Abca5 UTSW 11 110301527 missense probably benign 0.00
R0617:Abca5 UTSW 11 110279689 missense probably damaging 0.98
R0667:Abca5 UTSW 11 110327811 missense probably benign 0.00
R0844:Abca5 UTSW 11 110319832 missense probably benign 0.00
R1273:Abca5 UTSW 11 110326665 missense probably benign 0.01
R1463:Abca5 UTSW 11 110314558 missense probably damaging 1.00
R1511:Abca5 UTSW 11 110299978 missense probably damaging 1.00
R1511:Abca5 UTSW 11 110299986 missense possibly damaging 0.73
R1687:Abca5 UTSW 11 110293888 missense probably benign 0.32
R1759:Abca5 UTSW 11 110293848 missense probably benign
R1870:Abca5 UTSW 11 110329217 missense probably benign 0.33
R2006:Abca5 UTSW 11 110313449 missense probably benign
R2039:Abca5 UTSW 11 110299929 missense probably damaging 0.99
R2076:Abca5 UTSW 11 110287652 missense probably benign 0.10
R2136:Abca5 UTSW 11 110319832 missense probably benign 0.00
R2154:Abca5 UTSW 11 110292174 missense probably benign 0.00
R2273:Abca5 UTSW 11 110275281 missense possibly damaging 0.93
R2275:Abca5 UTSW 11 110275281 missense possibly damaging 0.93
R2328:Abca5 UTSW 11 110276521 missense probably damaging 0.99
R3702:Abca5 UTSW 11 110288058 splice site probably null
R3768:Abca5 UTSW 11 110313391 missense probably benign 0.01
R3872:Abca5 UTSW 11 110310233 missense probably damaging 1.00
R3873:Abca5 UTSW 11 110310233 missense probably damaging 1.00
R3874:Abca5 UTSW 11 110310233 missense probably damaging 1.00
R3875:Abca5 UTSW 11 110310233 missense probably damaging 1.00
R4347:Abca5 UTSW 11 110299968 missense probably damaging 1.00
R4429:Abca5 UTSW 11 110311410 missense probably benign 0.00
R4790:Abca5 UTSW 11 110311410 missense possibly damaging 0.63
R4812:Abca5 UTSW 11 110301821 missense probably damaging 1.00
R4833:Abca5 UTSW 11 110279316 missense probably benign 0.00
R4883:Abca5 UTSW 11 110326631 missense probably damaging 1.00
R5000:Abca5 UTSW 11 110310224 missense probably damaging 1.00
R5004:Abca5 UTSW 11 110279376 missense probably damaging 0.99
R5066:Abca5 UTSW 11 110309350 intron probably benign
R5230:Abca5 UTSW 11 110319860 missense probably benign
R5321:Abca5 UTSW 11 110327825 missense probably benign
R5350:Abca5 UTSW 11 110319796 nonsense probably null
R5414:Abca5 UTSW 11 110314622 missense probably damaging 1.00
R5437:Abca5 UTSW 11 110319796 nonsense probably null
R5451:Abca5 UTSW 11 110319796 nonsense probably null
R5453:Abca5 UTSW 11 110319796 nonsense probably null
R5488:Abca5 UTSW 11 110292183 missense probably benign 0.00
R5636:Abca5 UTSW 11 110301536 missense probably benign 0.00
R5805:Abca5 UTSW 11 110279390 missense probably benign 0.06
R5900:Abca5 UTSW 11 110279156 missense possibly damaging 0.92
R6152:Abca5 UTSW 11 110313361 missense probably damaging 1.00
R6167:Abca5 UTSW 11 110292105 missense probably benign 0.10
R6343:Abca5 UTSW 11 110314552 missense probably damaging 1.00
R6425:Abca5 UTSW 11 110329232 missense possibly damaging 0.75
R6493:Abca5 UTSW 11 110293878 missense probably benign 0.00
R6498:Abca5 UTSW 11 110292102 missense possibly damaging 0.70
R6884:Abca5 UTSW 11 110329217 missense probably damaging 0.96
R6912:Abca5 UTSW 11 110306280 missense probably benign 0.35
R7084:Abca5 UTSW 11 110301545 missense probably benign 0.22
R7239:Abca5 UTSW 11 110326704 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- CAACTGAAAGCGTAAATGTTTATGAT -3'
(R):5'- ACAGTCAAACCTTTAGCTCTTTCT -3'

Sequencing Primer
(F):5'- GCAGTGTGGAAAAGAACTCTTTCCC -3'
(R):5'- GGTAAAGGCTACTTTTTGGA -3'
Posted On2014-10-30