Mutagenetix > Incidental Mutation

Incidental Mutation 'R2293:Nup214'

245066

Institutional Source

Beutler Lab

Gene Symbol

Nup214

Ensembl Gene

ENSMUSG00000001855

Gene Name

nucleoporin 214

Synonyms

CAN, D2H9S46E

MMRRC Submission

040292-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R2293 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

31864446-31943204 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 31916887 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 1181 (S1181P)

Ref Sequence

ENSEMBL: ENSMUSP00000066492 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000065398]

AlphaFold

Q80U93

Predicted Effect

probably benign
Transcript: ENSMUST00000065398
AA Change: S1181P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000066492
Gene: ENSMUSG00000001855
AA Change: S1181P

Domain	Start	End	E-Value	Type
WD40	138	178	2.48e0	SMART
WD40	182	220	2.67e-1	SMART
low complexity region	428	441	N/A	INTRINSIC
low complexity region	449	467	N/A	INTRINSIC
low complexity region	474	493	N/A	INTRINSIC
low complexity region	529	546	N/A	INTRINSIC
low complexity region	620	640	N/A	INTRINSIC
low complexity region	645	656	N/A	INTRINSIC
coiled coil region	853	881	N/A	INTRINSIC
internal_repeat_1	969	993	1.13e-9	PROSPERO
internal_repeat_1	985	1009	1.13e-9	PROSPERO
low complexity region	1011	1026	N/A	INTRINSIC
low complexity region	1049	1064	N/A	INTRINSIC
low complexity region	1093	1111	N/A	INTRINSIC
low complexity region	1201	1215	N/A	INTRINSIC
low complexity region	1226	1248	N/A	INTRINSIC
low complexity region	1279	1296	N/A	INTRINSIC
low complexity region	1300	1311	N/A	INTRINSIC
low complexity region	1391	1426	N/A	INTRINSIC
low complexity region	1438	1454	N/A	INTRINSIC
low complexity region	1458	1505	N/A	INTRINSIC
low complexity region	1559	1573	N/A	INTRINSIC
low complexity region	1611	1642	N/A	INTRINSIC
low complexity region	1658	1670	N/A	INTRINSIC
low complexity region	1686	1715	N/A	INTRINSIC
low complexity region	1733	1748	N/A	INTRINSIC
low complexity region	1771	1783	N/A	INTRINSIC
low complexity region	1799	1832	N/A	INTRINSIC
low complexity region	1853	1872	N/A	INTRINSIC
low complexity region	1877	1886	N/A	INTRINSIC
low complexity region	1898	1910	N/A	INTRINSIC
low complexity region	1925	1934	N/A	INTRINSIC
low complexity region	1969	1995	N/A	INTRINSIC
low complexity region	2007	2032	N/A	INTRINSIC
low complexity region	2048	2076	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000123062

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The nuclear pore complex is a massive structure that extends across the nuclear envelope, forming a gateway that regulates the flow of macromolecules between the nucleus and the cytoplasm. Nucleoporins are the main components of the nuclear pore complex in eukaryotic cells. This gene is a member of the FG-repeat-containing nucleoporins. The protein encoded by this gene is localized to the cytoplasmic face of the nuclear pore complex where it is required for proper cell cycle progression and nucleocytoplasmic transport. The 3' portion of this gene forms a fusion gene with the DEK gene on chromosome 6 in a t(6,9) translocation associated with acute myeloid leukemia and myelodysplastic syndrome. Alternative splicing of this gene results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
PHENOTYPE: Embryos homozygous for a null mutation die between 4.0 and 4.5 dpc, following depletion of maternally-derived gene product. In vitro, cultured 3.5-dpc mutant embryos arrest in the G2 phase, and show blastocoel contraction with defects in NLS-mediated protein import and polyadenylated RNA export. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 22 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ano9	T	C	7: 140,682,428 (GRCm39)	N640S	probably benign	Het
Aox4	T	A	1: 58,261,096 (GRCm39)	I143N	probably damaging	Het
Arhgef11	C	T	3: 87,635,297 (GRCm39)	R869C	probably damaging	Het
Bcl6	T	C	16: 23,796,359 (GRCm39)	N23D	probably damaging	Het
Brca2	T	A	5: 150,483,999 (GRCm39)	F2939L	possibly damaging	Het
Bsn	C	T	9: 107,990,266 (GRCm39)	A1829T	possibly damaging	Het
Cyp2j6	T	A	4: 96,417,670 (GRCm39)	T318S	possibly damaging	Het
Dlg5	A	C	14: 24,208,180 (GRCm39)	S1009A	probably benign	Het
Dlx6	A	G	6: 6,867,246 (GRCm39)	Y283C	probably damaging	Het
Dnah10	T	C	5: 124,896,285 (GRCm39)	Y3550H	probably damaging	Het
Dock7	T	C	4: 98,854,606 (GRCm39)	S1553G	probably damaging	Het
Ice1	C	A	13: 70,763,076 (GRCm39)	D193Y	probably damaging	Het
Mdga2	A	T	12: 66,615,759 (GRCm39)	L547*	probably null	Het
Mgat4a	C	A	1: 37,491,673 (GRCm39)	R215L	probably damaging	Het
Msantd2	A	G	9: 37,401,100 (GRCm39)	T69A	probably damaging	Het
Muc5ac	A	G	7: 141,360,936 (GRCm39)	T1416A	probably damaging	Het
Pip5k1c	A	G	10: 81,149,918 (GRCm39)	E42G	possibly damaging	Het
Slc12a5	A	G	2: 164,834,250 (GRCm39)	E757G	probably benign	Het
Slc16a14	A	T	1: 84,890,564 (GRCm39)	M247K	probably benign	Het
Slc35b2	T	A	17: 45,878,067 (GRCm39)	V398E	probably damaging	Het
Slc44a5	C	A	3: 153,945,934 (GRCm39)	L156I	probably benign	Het
Trmt11	G	C	10: 30,423,744 (GRCm39)	P387R	probably damaging	Het

Other mutations in Nup214

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00490:Nup214	APN	2	31,923,991 (GRCm39)	missense	probably damaging	1.00
IGL00649:Nup214	APN	2	31,896,733 (GRCm39)	missense	probably benign	0.27
IGL01149:Nup214	APN	2	31,924,712 (GRCm39)	missense	probably damaging	1.00
IGL01360:Nup214	APN	2	31,928,190 (GRCm39)	unclassified	probably benign
IGL01409:Nup214	APN	2	31,916,943 (GRCm39)	splice site	probably null
IGL01530:Nup214	APN	2	31,923,733 (GRCm39)	missense	probably benign
IGL01554:Nup214	APN	2	31,941,084 (GRCm39)	nonsense	probably null
IGL01944:Nup214	APN	2	31,924,971 (GRCm39)	nonsense	probably null
IGL02296:Nup214	APN	2	31,878,200 (GRCm39)	missense	possibly damaging	0.65
IGL02563:Nup214	APN	2	31,867,872 (GRCm39)	missense	probably damaging	1.00
IGL02688:Nup214	APN	2	31,921,287 (GRCm39)	missense	probably benign
IGL02858:Nup214	APN	2	31,900,384 (GRCm39)	splice site	probably benign
IGL02953:Nup214	APN	2	31,878,241 (GRCm39)	missense	possibly damaging	0.87
IGL03090:Nup214	APN	2	31,908,254 (GRCm39)	missense	probably benign	0.01
IGL03124:Nup214	APN	2	31,886,452 (GRCm39)	missense	probably benign	0.27
IGL03225:Nup214	APN	2	31,924,423 (GRCm39)	missense	probably damaging	1.00
IGL03375:Nup214	APN	2	31,900,233 (GRCm39)	missense	probably damaging	0.97
Des_moines	UTSW	2	31,870,596 (GRCm39)	splice site	probably null
ANU74:Nup214	UTSW	2	31,924,978 (GRCm39)	missense	probably damaging	0.99
R0035:Nup214	UTSW	2	31,880,379 (GRCm39)	splice site	probably null
R0243:Nup214	UTSW	2	31,888,069 (GRCm39)	splice site	probably benign
R0270:Nup214	UTSW	2	31,924,826 (GRCm39)	missense	probably damaging	0.96
R0358:Nup214	UTSW	2	31,894,312 (GRCm39)	splice site	probably null
R1168:Nup214	UTSW	2	31,915,313 (GRCm39)	missense	probably benign
R1242:Nup214	UTSW	2	31,867,782 (GRCm39)	missense	probably benign	0.00
R1481:Nup214	UTSW	2	31,924,478 (GRCm39)	missense	probably damaging	1.00
R1482:Nup214	UTSW	2	31,924,478 (GRCm39)	missense	probably damaging	1.00
R1579:Nup214	UTSW	2	31,924,478 (GRCm39)	missense	probably damaging	1.00
R1580:Nup214	UTSW	2	31,924,478 (GRCm39)	missense	probably damaging	1.00
R1581:Nup214	UTSW	2	31,924,478 (GRCm39)	missense	probably damaging	1.00
R1610:Nup214	UTSW	2	31,924,478 (GRCm39)	missense	probably damaging	1.00
R1894:Nup214	UTSW	2	31,886,392 (GRCm39)	missense	possibly damaging	0.66
R2146:Nup214	UTSW	2	31,924,478 (GRCm39)	missense	probably damaging	1.00
R2149:Nup214	UTSW	2	31,924,478 (GRCm39)	missense	probably damaging	1.00
R2924:Nup214	UTSW	2	31,888,015 (GRCm39)	missense	probably damaging	1.00
R2925:Nup214	UTSW	2	31,888,015 (GRCm39)	missense	probably damaging	1.00
R3037:Nup214	UTSW	2	31,866,632 (GRCm39)	missense	probably benign	0.00
R3426:Nup214	UTSW	2	31,923,415 (GRCm39)	missense	probably damaging	0.97
R3799:Nup214	UTSW	2	31,924,694 (GRCm39)	missense	probably damaging	1.00
R3843:Nup214	UTSW	2	31,941,112 (GRCm39)	missense	probably damaging	1.00
R4323:Nup214	UTSW	2	31,884,696 (GRCm39)	missense	probably benign
R4353:Nup214	UTSW	2	31,867,929 (GRCm39)	critical splice donor site	probably null
R4601:Nup214	UTSW	2	31,887,977 (GRCm39)	missense	probably benign	0.36
R4626:Nup214	UTSW	2	31,923,416 (GRCm39)	missense	possibly damaging	0.92
R4874:Nup214	UTSW	2	31,870,596 (GRCm39)	splice site	probably null
R4938:Nup214	UTSW	2	31,873,171 (GRCm39)	missense	probably benign	0.00
R4939:Nup214	UTSW	2	31,873,171 (GRCm39)	missense	probably benign	0.00
R5027:Nup214	UTSW	2	31,881,329 (GRCm39)	missense	probably damaging	1.00
R5358:Nup214	UTSW	2	31,907,158 (GRCm39)	missense	unknown
R5406:Nup214	UTSW	2	31,892,619 (GRCm39)	missense	probably damaging	0.96
R5507:Nup214	UTSW	2	31,878,188 (GRCm39)	missense	possibly damaging	0.87
R5695:Nup214	UTSW	2	31,924,385 (GRCm39)	missense	probably damaging	1.00
R5744:Nup214	UTSW	2	31,900,308 (GRCm39)	missense	probably damaging	0.97
R5908:Nup214	UTSW	2	31,881,353 (GRCm39)	missense	probably benign	0.03
R5967:Nup214	UTSW	2	31,869,790 (GRCm39)	missense	possibly damaging	0.52
R6140:Nup214	UTSW	2	31,941,808 (GRCm39)	missense	possibly damaging	0.92
R6243:Nup214	UTSW	2	31,892,944 (GRCm39)	missense	possibly damaging	0.81
R6488:Nup214	UTSW	2	31,881,384 (GRCm39)	missense	possibly damaging	0.93
R6934:Nup214	UTSW	2	31,872,683 (GRCm39)	nonsense	probably null
R6970:Nup214	UTSW	2	31,941,810 (GRCm39)	missense	probably damaging	1.00
R7028:Nup214	UTSW	2	31,924,168 (GRCm39)	missense	probably benign	0.22
R7114:Nup214	UTSW	2	31,915,256 (GRCm39)	missense	possibly damaging	0.83
R7120:Nup214	UTSW	2	31,941,054 (GRCm39)	missense	probably benign	0.07
R7249:Nup214	UTSW	2	31,878,245 (GRCm39)	missense	possibly damaging	0.92
R7821:Nup214	UTSW	2	31,916,917 (GRCm39)	missense	possibly damaging	0.83
R8026:Nup214	UTSW	2	31,923,362 (GRCm39)	missense	possibly damaging	0.55
R8264:Nup214	UTSW	2	31,884,738 (GRCm39)	missense	possibly damaging	0.79
R8284:Nup214	UTSW	2	31,886,458 (GRCm39)	missense	possibly damaging	0.83
R8356:Nup214	UTSW	2	31,929,372 (GRCm39)	missense	probably benign	0.05
R8397:Nup214	UTSW	2	31,880,266 (GRCm39)	missense	probably damaging	0.96
R8456:Nup214	UTSW	2	31,929,372 (GRCm39)	missense	probably benign	0.05
R8785:Nup214	UTSW	2	31,924,465 (GRCm39)	missense	probably damaging	0.97
R9257:Nup214	UTSW	2	31,923,347 (GRCm39)	missense	possibly damaging	0.92
R9291:Nup214	UTSW	2	31,867,806 (GRCm39)	missense	probably benign	0.00
R9376:Nup214	UTSW	2	31,924,244 (GRCm39)	missense	probably benign	0.00
R9408:Nup214	UTSW	2	31,937,523 (GRCm39)	missense	probably damaging	1.00
R9613:Nup214	UTSW	2	31,901,035 (GRCm39)	missense	possibly damaging	0.90
R9789:Nup214	UTSW	2	31,907,227 (GRCm39)	missense	possibly damaging	0.46
RF015:Nup214	UTSW	2	31,924,718 (GRCm39)	missense	probably benign	0.00
X0026:Nup214	UTSW	2	31,910,318 (GRCm39)	missense	possibly damaging	0.46
X0065:Nup214	UTSW	2	31,932,488 (GRCm39)	missense	probably damaging	1.00
Z1088:Nup214	UTSW	2	31,901,235 (GRCm39)	missense	probably benign	0.27
Z1176:Nup214	UTSW	2	31,924,237 (GRCm39)	nonsense	probably null
Z1176:Nup214	UTSW	2	31,900,270 (GRCm39)	missense	possibly damaging	0.66
Z1177:Nup214	UTSW	2	31,887,971 (GRCm39)	missense	possibly damaging	0.83

Predicted Primers

PCR Primer
(F):5'- ATGCAGAAGCCTCCAGTGTG -3'
(R):5'- GGACTTATCGATGTCCTTACAATTC -3'

Sequencing Primer
(F):5'- AGCCTCCAGTGTGGTGTTATATTTTG -3'
(R):5'- GTCCTTACAATTCCTCAAAACTGAG -3'

Posted On

2014-10-30