Incidental Mutation 'R2294:Slc6a21'
ID245098
Institutional Source Beutler Lab
Gene Symbol Slc6a21
Ensembl Gene ENSMUSG00000070568
Gene Namesolute carrier family 6 member 21
Synonyms1700039E15Rik
MMRRC Submission 040293-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.052) question?
Stock #R2294 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location45277513-45288998 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 45280528 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 147 (A147T)
Ref Sequence ENSEMBL: ENSMUSP00000147890 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085364] [ENSMUST00000210861]
Predicted Effect probably benign
Transcript: ENSMUST00000085364
SMART Domains Protein: ENSMUSP00000082476
Gene: ENSMUSG00000070568

DomainStartEndE-ValueType
Pfam:SNF 1 306 8.3e-37 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000176276
AA Change: A147T

PolyPhen 2 Score 0.832 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000135707
Gene: ENSMUSG00000070568
AA Change: A147T

DomainStartEndE-ValueType
Pfam:SNF 48 631 2e-103 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209477
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209886
Predicted Effect probably benign
Transcript: ENSMUST00000210207
Predicted Effect possibly damaging
Transcript: ENSMUST00000210861
AA Change: A147T

PolyPhen 2 Score 0.832 (Sensitivity: 0.84; Specificity: 0.93)
Meta Mutation Damage Score 0.0464 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 100% (30/30)
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy6 C T 15: 98,597,441 V673I possibly damaging Het
Bsn C T 9: 108,113,067 A1829T possibly damaging Het
Chchd3 T C 6: 32,852,187 E166G probably damaging Het
Chrna7 A T 7: 63,110,424 S135T probably benign Het
Dxo G A 17: 34,838,986 probably null Het
Fbxw18 A G 9: 109,676,797 S469P probably damaging Het
G3bp2 G A 5: 92,058,028 R290C probably damaging Het
Hydin T C 8: 110,299,959 L103P probably damaging Het
Lrig3 C T 10: 125,966,494 R7* probably null Het
Lrp6 A G 6: 134,457,742 C1333R probably damaging Het
Luzp2 T C 7: 55,172,190 probably benign Het
Lypd8 A T 11: 58,386,854 N154I probably damaging Het
Ndufs1 A T 1: 63,160,996 D252E probably damaging Het
Nos3 T A 5: 24,364,857 V7E probably damaging Het
Olfr393 A G 11: 73,847,486 L213P probably damaging Het
Osbpl6 A T 2: 76,577,079 D446V possibly damaging Het
Pik3c2b C A 1: 133,066,775 P159H probably damaging Het
Pkhd1l1 C T 15: 44,479,607 T160I probably damaging Het
Prelid3a C T 18: 67,472,871 T16M probably damaging Het
Prl7b1 A T 13: 27,602,871 M125K possibly damaging Het
Rars C A 11: 35,817,536 probably benign Het
Ripk1 A G 13: 34,017,008 T235A probably benign Het
Slc38a2 C A 15: 96,691,762 V363L probably benign Het
Tgfb3 T C 12: 86,069,910 N118S probably benign Het
Tmem175 T C 5: 108,638,659 probably benign Het
Tmem232 A T 17: 65,450,441 N252K probably benign Het
Trappc8 G T 18: 20,866,154 C305* probably null Het
Tyro3 T C 2: 119,805,645 V223A probably damaging Het
Yipf2 C T 9: 21,589,881 V74M probably damaging Het
Other mutations in Slc6a21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00966:Slc6a21 APN 7 45288244 missense probably benign 0.31
IGL01526:Slc6a21 APN 7 45287796 missense probably damaging 1.00
IGL01670:Slc6a21 APN 7 45288133 missense possibly damaging 0.91
IGL01975:Slc6a21 APN 7 45287851 missense probably benign 0.28
IGL02064:Slc6a21 APN 7 45286459 missense possibly damaging 0.71
IGL02441:Slc6a21 APN 7 45288081 missense probably damaging 1.00
IGL02735:Slc6a21 APN 7 45286637 splice site probably benign
IGL03097:Slc6a21 UTSW 7 45288168 nonsense probably null
R0211:Slc6a21 UTSW 7 45288243 missense possibly damaging 0.90
R0211:Slc6a21 UTSW 7 45288243 missense possibly damaging 0.90
R0269:Slc6a21 UTSW 7 45286908 nonsense probably null
R0336:Slc6a21 UTSW 7 45286468 missense probably damaging 1.00
R1077:Slc6a21 UTSW 7 45288202 missense probably benign 0.42
R1476:Slc6a21 UTSW 7 45272628 missense probably benign 0.09
R1763:Slc6a21 UTSW 7 45287734 nonsense probably null
R1792:Slc6a21 UTSW 7 45280731 missense probably benign 0.04
R1796:Slc6a21 UTSW 7 45280755 missense probably damaging 1.00
R1812:Slc6a21 UTSW 7 45282947 missense probably damaging 1.00
R1868:Slc6a21 UTSW 7 45287828 missense probably benign 0.13
R2121:Slc6a21 UTSW 7 45288462 missense probably benign 0.04
R2129:Slc6a21 UTSW 7 45282773 unclassified probably null
R2295:Slc6a21 UTSW 7 45280528 missense possibly damaging 0.83
R2409:Slc6a21 UTSW 7 45280326 missense probably benign 0.15
R2858:Slc6a21 UTSW 7 45280528 missense possibly damaging 0.83
R3498:Slc6a21 UTSW 7 45280842 missense probably damaging 1.00
R3751:Slc6a21 UTSW 7 45280504 missense probably benign
R4297:Slc6a21 UTSW 7 45287762 missense possibly damaging 0.95
R4510:Slc6a21 UTSW 7 45287289 missense probably damaging 1.00
R4511:Slc6a21 UTSW 7 45287289 missense probably damaging 1.00
R4876:Slc6a21 UTSW 7 45280111 nonsense probably null
R4921:Slc6a21 UTSW 7 45288310 missense possibly damaging 0.53
R5485:Slc6a21 UTSW 7 45282542 critical splice donor site probably null
R5559:Slc6a21 UTSW 7 45288429 missense possibly damaging 0.61
R6305:Slc6a21 UTSW 7 45280604 missense possibly damaging 0.88
R6390:Slc6a21 UTSW 7 45287002 missense probably benign 0.02
R6571:Slc6a21 UTSW 7 45280879 missense probably damaging 0.99
R6792:Slc6a21 UTSW 7 45279885 start codon destroyed probably null 0.02
R7235:Slc6a21 UTSW 7 45280758 missense probably damaging 0.99
R7278:Slc6a21 UTSW 7 45282480 missense possibly damaging 0.84
Predicted Primers PCR Primer
(F):5'- ACAGTGGCTACGTATGGACAAC -3'
(R):5'- TCTGACCAAAGGCAGGTATTG -3'

Sequencing Primer
(F):5'- GGGCTACTCCAACATACT -3'
(R):5'- ATTGCCTGCTGAGGAGGGTAG -3'
Posted On2014-10-30