Incidental Mutation 'R2295:Svopl'
ID245137
Institutional Source Beutler Lab
Gene Symbol Svopl
Ensembl Gene ENSMUSG00000029830
Gene NameSV2 related protein homolog (rat)-like
Synonyms9430071P14Rik
MMRRC Submission 040294-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2295 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location37983739-38046996 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 38019733 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 270 (A270S)
Ref Sequence ENSEMBL: ENSMUSP00000093743 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096040]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000040486
Predicted Effect possibly damaging
Transcript: ENSMUST00000096040
AA Change: A270S

PolyPhen 2 Score 0.522 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000093743
Gene: ENSMUSG00000029830
AA Change: A270S

DomainStartEndE-ValueType
Pfam:Sugar_tr 17 297 5.5e-20 PFAM
Pfam:MFS_1 50 308 2.1e-20 PFAM
transmembrane domain 349 371 N/A INTRINSIC
transmembrane domain 384 406 N/A INTRINSIC
transmembrane domain 459 481 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172585
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173428
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200796
Meta Mutation Damage Score 0.024 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is thought to be a member of solute carrier family 22, which includes transmembrane proteins that transport toxins and drugs from the body. This gene is a paralog of the SVOP gene that encodes synaptic vesicle 2-related protein. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 T C 11: 110,148,903 Y428C probably damaging Het
Adgrd1 G A 5: 129,122,506 V136I probably benign Het
Aldh5a1 A G 13: 24,926,099 F151S probably damaging Het
Alox12 T C 11: 70,242,465 I638V probably benign Het
Arhgap42 A T 9: 9,115,744 D110E probably damaging Het
Capn15 G A 17: 25,964,581 R309* probably null Het
Crmp1 A G 5: 37,265,262 I138V probably benign Het
Dennd3 G A 15: 73,523,555 probably null Het
Dsp T C 13: 38,197,046 V1990A probably benign Het
Dtna T G 18: 23,631,412 L546R probably damaging Het
Elac1 T C 18: 73,739,229 I232V probably benign Het
Hdgfl1 C T 13: 26,769,362 E243K possibly damaging Het
Hexb A G 13: 97,185,612 S222P probably damaging Het
Hs6st3 A G 14: 119,138,445 T11A probably benign Het
Il18 A G 9: 50,579,335 E90G probably benign Het
Itga8 T C 2: 12,182,709 T720A probably benign Het
Kcnt1 G T 2: 25,900,921 A11S probably damaging Het
Luzp2 T C 7: 55,172,190 probably benign Het
Mpped2 A G 2: 106,699,501 N32D possibly damaging Het
Nfic T C 10: 81,420,531 K122E probably damaging Het
Ntm A G 9: 29,109,521 V134A possibly damaging Het
Olfml2b G A 1: 170,662,538 probably benign Het
Olfr1497 A T 19: 13,794,744 I289N probably damaging Het
Olfr684 A G 7: 105,157,325 V119A probably benign Het
Osbpl9 A G 4: 109,202,134 Y28H probably damaging Het
Pikfyve T A 1: 65,246,676 Y1025N probably damaging Het
Pip5k1c G A 10: 81,305,186 A43T probably benign Het
Polb A G 8: 22,653,319 L19P probably damaging Het
Ppp1r14c T C 10: 3,366,734 F23S possibly damaging Het
Prkab1 A T 5: 116,021,656 probably null Het
Slc6a21 G A 7: 45,280,528 A147T possibly damaging Het
Slco6c1 A G 1: 97,125,748 S143P probably damaging Het
Spen T C 4: 141,477,273 N1348D unknown Het
Srgap1 T C 10: 121,794,760 K751R probably benign Het
Sult2a1 A G 7: 13,835,959 probably null Het
Tekt2 T C 4: 126,323,693 probably null Het
Toporsl A G 4: 52,610,176 D23G probably damaging Het
Trim30d A C 7: 104,487,942 C18W probably damaging Het
Trmt11 G C 10: 30,547,748 P387R probably damaging Het
Other mutations in Svopl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00742:Svopl APN 6 38031017 critical splice donor site probably null
IGL01531:Svopl APN 6 38026941 splice site probably benign
IGL02161:Svopl APN 6 38036815 splice site probably benign
IGL02554:Svopl APN 6 38017043 missense probably damaging 0.99
IGL03249:Svopl APN 6 38017053 missense probably benign 0.05
PIT4434001:Svopl UTSW 6 38014866 missense possibly damaging 0.85
R0285:Svopl UTSW 6 37984522 missense probably benign 0.02
R0423:Svopl UTSW 6 38036707 splice site probably benign
R0692:Svopl UTSW 6 38017196 missense probably damaging 1.00
R0960:Svopl UTSW 6 38017057 nonsense probably null
R1163:Svopl UTSW 6 38029700 missense possibly damaging 0.89
R1526:Svopl UTSW 6 38029635 missense probably benign 0.03
R2302:Svopl UTSW 6 38041166 splice site probably benign
R5933:Svopl UTSW 6 38017014 splice site probably benign
R6367:Svopl UTSW 6 38019679 missense possibly damaging 0.88
R6595:Svopl UTSW 6 38041067 splice site probably null
R6903:Svopl UTSW 6 38021608 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GAGTATCCTCCAAATACCTGTTTG -3'
(R):5'- AACACATCAGTCTTTTGGGTTTGG -3'

Sequencing Primer
(F):5'- GTCCAGGAATTCACTATGTAGCCAG -3'
(R):5'- GTGGGGAAAGGGCCTCCTAAC -3'
Posted On2014-10-30