Incidental Mutation 'R2295:Srgap1'
ID245151
Institutional Source Beutler Lab
Gene Symbol Srgap1
Ensembl Gene ENSMUSG00000020121
Gene NameSLIT-ROBO Rho GTPase activating protein 1
SynonymsArhgap13, 4930572H05Rik
MMRRC Submission 040294-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.256) question?
Stock #R2295 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location121780991-122047315 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 121794760 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 751 (K751R)
Ref Sequence ENSEMBL: ENSMUSP00000080389 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020322] [ENSMUST00000081688]
Predicted Effect probably benign
Transcript: ENSMUST00000020322
AA Change: K728R

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000020322
Gene: ENSMUSG00000020121
AA Change: K728R

DomainStartEndE-ValueType
FCH 22 121 3.81e-16 SMART
low complexity region 173 193 N/A INTRINSIC
coiled coil region 352 382 N/A INTRINSIC
low complexity region 405 418 N/A INTRINSIC
RhoGAP 494 668 1.27e-64 SMART
SH3 723 778 1.57e-14 SMART
low complexity region 826 840 N/A INTRINSIC
low complexity region 1004 1014 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000081688
AA Change: K751R

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000080389
Gene: ENSMUSG00000020121
AA Change: K751R

DomainStartEndE-ValueType
FCH 22 121 3.81e-16 SMART
low complexity region 173 193 N/A INTRINSIC
coiled coil region 352 382 N/A INTRINSIC
low complexity region 405 418 N/A INTRINSIC
RhoGAP 517 691 1.27e-64 SMART
SH3 746 801 1.57e-14 SMART
low complexity region 849 863 N/A INTRINSIC
low complexity region 1027 1037 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161996
Meta Mutation Damage Score 0.086 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a GTPase activator, working with the GTPase CDC42 to negatively regulate neuronal migration. The encoded protein interacts with the transmembrane receptor ROBO1 to inactivate CDC42. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 T C 11: 110,148,903 Y428C probably damaging Het
Adgrd1 G A 5: 129,122,506 V136I probably benign Het
Aldh5a1 A G 13: 24,926,099 F151S probably damaging Het
Alox12 T C 11: 70,242,465 I638V probably benign Het
Arhgap42 A T 9: 9,115,744 D110E probably damaging Het
Capn15 G A 17: 25,964,581 R309* probably null Het
Crmp1 A G 5: 37,265,262 I138V probably benign Het
Dennd3 G A 15: 73,523,555 probably null Het
Dsp T C 13: 38,197,046 V1990A probably benign Het
Dtna T G 18: 23,631,412 L546R probably damaging Het
Elac1 T C 18: 73,739,229 I232V probably benign Het
Hdgfl1 C T 13: 26,769,362 E243K possibly damaging Het
Hexb A G 13: 97,185,612 S222P probably damaging Het
Hs6st3 A G 14: 119,138,445 T11A probably benign Het
Il18 A G 9: 50,579,335 E90G probably benign Het
Itga8 T C 2: 12,182,709 T720A probably benign Het
Kcnt1 G T 2: 25,900,921 A11S probably damaging Het
Luzp2 T C 7: 55,172,190 probably benign Het
Mpped2 A G 2: 106,699,501 N32D possibly damaging Het
Nfic T C 10: 81,420,531 K122E probably damaging Het
Ntm A G 9: 29,109,521 V134A possibly damaging Het
Olfml2b G A 1: 170,662,538 probably benign Het
Olfr1497 A T 19: 13,794,744 I289N probably damaging Het
Olfr684 A G 7: 105,157,325 V119A probably benign Het
Osbpl9 A G 4: 109,202,134 Y28H probably damaging Het
Pikfyve T A 1: 65,246,676 Y1025N probably damaging Het
Pip5k1c G A 10: 81,305,186 A43T probably benign Het
Polb A G 8: 22,653,319 L19P probably damaging Het
Ppp1r14c T C 10: 3,366,734 F23S possibly damaging Het
Prkab1 A T 5: 116,021,656 probably null Het
Slc6a21 G A 7: 45,280,528 A147T possibly damaging Het
Slco6c1 A G 1: 97,125,748 S143P probably damaging Het
Spen T C 4: 141,477,273 N1348D unknown Het
Sult2a1 A G 7: 13,835,959 probably null Het
Svopl C A 6: 38,019,733 A270S possibly damaging Het
Tekt2 T C 4: 126,323,693 probably null Het
Toporsl A G 4: 52,610,176 D23G probably damaging Het
Trim30d A C 7: 104,487,942 C18W probably damaging Het
Trmt11 G C 10: 30,547,748 P387R probably damaging Het
Other mutations in Srgap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01964:Srgap1 APN 10 121804966 missense possibly damaging 0.81
IGL02106:Srgap1 APN 10 121785693 missense possibly damaging 0.95
IGL02927:Srgap1 APN 10 121855462 missense probably damaging 0.99
IGL03088:Srgap1 APN 10 121825693 missense possibly damaging 0.94
IGL03208:Srgap1 APN 10 121792266 missense possibly damaging 0.89
IGL03251:Srgap1 APN 10 121804921 unclassified probably null
PIT1430001:Srgap1 UTSW 10 121896753 splice site probably benign
R0052:Srgap1 UTSW 10 121800827 missense possibly damaging 0.94
R0052:Srgap1 UTSW 10 121800827 missense possibly damaging 0.94
R0356:Srgap1 UTSW 10 121855536 splice site probably null
R0361:Srgap1 UTSW 10 122047192 start codon destroyed probably null 0.89
R0365:Srgap1 UTSW 10 121785705 missense possibly damaging 0.80
R0675:Srgap1 UTSW 10 121792235 missense probably damaging 1.00
R0801:Srgap1 UTSW 10 121807875 missense probably damaging 0.96
R0815:Srgap1 UTSW 10 121785474 missense probably damaging 0.99
R1034:Srgap1 UTSW 10 121785445 missense possibly damaging 0.69
R1160:Srgap1 UTSW 10 121855477 missense probably benign 0.01
R1454:Srgap1 UTSW 10 121896738 missense probably damaging 0.99
R1624:Srgap1 UTSW 10 121855373 missense probably benign 0.03
R1628:Srgap1 UTSW 10 121870339 missense probably benign 0.15
R1816:Srgap1 UTSW 10 121925971 nonsense probably null
R1933:Srgap1 UTSW 10 121925903 missense possibly damaging 0.89
R2034:Srgap1 UTSW 10 121792746 missense probably damaging 0.98
R2211:Srgap1 UTSW 10 121853740 missense possibly damaging 0.55
R2368:Srgap1 UTSW 10 121829289 missense probably benign 0.05
R3796:Srgap1 UTSW 10 122047132 missense probably benign 0.06
R4083:Srgap1 UTSW 10 121785690 missense probably damaging 1.00
R4172:Srgap1 UTSW 10 121855363 missense probably benign 0.00
R4322:Srgap1 UTSW 10 121869806 missense probably damaging 1.00
R4401:Srgap1 UTSW 10 121804921 unclassified probably null
R4513:Srgap1 UTSW 10 121870326 critical splice donor site probably null
R4698:Srgap1 UTSW 10 121792487 missense probably benign 0.22
R4776:Srgap1 UTSW 10 121792351 missense probably benign 0.03
R4951:Srgap1 UTSW 10 121785552 missense probably benign 0.20
R5116:Srgap1 UTSW 10 121792379 missense possibly damaging 0.77
R5232:Srgap1 UTSW 10 121840911 missense probably benign 0.00
R5237:Srgap1 UTSW 10 121807883 missense probably damaging 1.00
R5335:Srgap1 UTSW 10 121785377 utr 3 prime probably benign
R5402:Srgap1 UTSW 10 121785760 missense probably benign 0.06
R5432:Srgap1 UTSW 10 121869823 missense probably damaging 1.00
R5456:Srgap1 UTSW 10 121869811 missense probably benign 0.45
R5669:Srgap1 UTSW 10 121804850 missense probably benign 0.00
R5682:Srgap1 UTSW 10 121805014 missense probably damaging 1.00
R5687:Srgap1 UTSW 10 121825636 missense probably damaging 1.00
R5773:Srgap1 UTSW 10 121896709 missense probably benign 0.02
R5832:Srgap1 UTSW 10 121840914 missense probably damaging 1.00
R6028:Srgap1 UTSW 10 121828730 missense probably null
R6240:Srgap1 UTSW 10 122047156 missense probably benign 0.06
R6336:Srgap1 UTSW 10 121925941 missense probably benign 0.01
R6435:Srgap1 UTSW 10 121800827 missense possibly damaging 0.94
R6597:Srgap1 UTSW 10 121792371 missense probably benign 0.11
R6798:Srgap1 UTSW 10 121925904 missense probably damaging 1.00
R6807:Srgap1 UTSW 10 121828726 splice site probably null
R6897:Srgap1 UTSW 10 121785618 missense probably damaging 0.96
X0063:Srgap1 UTSW 10 121785412 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AGGGGTTGAATTCTGTGCCC -3'
(R):5'- TGACAACTAGAAGTATCTCCCTCC -3'

Sequencing Primer
(F):5'- GACCCTCTAATAGCTGGGATTC -3'
(R):5'- ACTAGAAGTATCTCCCTCCCCACTC -3'
Posted On2014-10-30