Incidental Mutation 'R2296:Grm7'
ID 245174
Institutional Source Beutler Lab
Gene Symbol Grm7
Ensembl Gene ENSMUSG00000056755
Gene Name glutamate receptor, metabotropic 7
Synonyms 6330570A01Rik, Gpr1g, mGlu7a receptor, mGluR7, E130018M02Rik
MMRRC Submission 040295-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2296 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 110622542-111544191 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 110623309 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Phenylalanine at position 161 (V161F)
Ref Sequence ENSEMBL: ENSMUSP00000134635 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071076] [ENSMUST00000172951] [ENSMUST00000174018]
AlphaFold Q68ED2
Predicted Effect probably damaging
Transcript: ENSMUST00000071076
AA Change: V161F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000064404
Gene: ENSMUSG00000056755
AA Change: V161F

DomainStartEndE-ValueType
low complexity region 18 32 N/A INTRINSIC
Pfam:ANF_receptor 77 484 3e-108 PFAM
Pfam:Peripla_BP_6 144 371 3e-11 PFAM
Pfam:NCD3G 519 569 1.2e-13 PFAM
Pfam:7tm_3 602 847 5.1e-59 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000172951
AA Change: V161F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000133957
Gene: ENSMUSG00000056755
AA Change: V161F

DomainStartEndE-ValueType
low complexity region 18 32 N/A INTRINSIC
Pfam:ANF_receptor 77 484 1.7e-103 PFAM
Pfam:Peripla_BP_6 144 487 1e-12 PFAM
Pfam:NCD3G 519 569 1.2e-17 PFAM
Pfam:7tm_3 600 848 1.4e-87 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173609
Predicted Effect probably damaging
Transcript: ENSMUST00000174018
AA Change: V161F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134635
Gene: ENSMUSG00000056755
AA Change: V161F

DomainStartEndE-ValueType
low complexity region 18 32 N/A INTRINSIC
Pfam:ANF_receptor 77 176 4.9e-20 PFAM
Meta Mutation Damage Score 0.2357 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] L-glutamate is the major excitatory neurotransmitter in the central nervous system, and it activates both ionotropic and metabotropic glutamate receptors. Glutamatergic neurotransmission is involved in most aspects of normal brain function and can be perturbed in many neuropathologic conditions. The metabotropic glutamate receptors are a family of G protein-coupled receptors that have been divided into three groups on the basis of sequence homology, putative signal transduction mechanisms, and pharmacologic properties. Group I includes GRM1 and GRM5, and these receptors have been shown to activate phospholipase C. Group II includes GRM2 and GRM3, while Group III includes GRM4, GRM6, GRM7 and GRM8. Group II and III receptors are linked to the inhibition of the cyclic AMP cascade but differ in their agonist selectivities. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2009]
PHENOTYPE: Nullizygous mice exhibit epilepsy and deficits in fear response and conditioned taste aversion. Homozygotes for a knock-in allele show impaired spatial working memory and higher susceptibility to PTZ. Homozygotes for a reporter allele show impaired coordination and higher susceptibility to metrazol. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik A G 1: 11,582,275 (GRCm39) E68G possibly damaging Het
Apob A G 12: 8,044,879 (GRCm39) D820G probably damaging Het
Bglap3 G C 3: 88,276,819 (GRCm39) probably benign Het
Calr3 C T 8: 73,178,469 (GRCm39) probably benign Het
Carmil1 A G 13: 24,299,492 (GRCm39) L344P probably damaging Het
Cop1 G A 1: 159,072,220 (GRCm39) V109M possibly damaging Het
Dennd4b T A 3: 90,182,821 (GRCm39) N879K probably damaging Het
Fam13b T C 18: 34,627,814 (GRCm39) D129G possibly damaging Het
Fam222a C A 5: 114,749,027 (GRCm39) H74Q possibly damaging Het
Gata5 A G 2: 179,970,113 (GRCm39) M278T possibly damaging Het
Iigp1c T A 18: 60,378,542 (GRCm39) C26S probably benign Het
Inpp5k T G 11: 75,530,313 (GRCm39) L251R probably damaging Het
Lrrc36 T G 8: 106,187,651 (GRCm39) D522E possibly damaging Het
Mrc2 G A 11: 105,239,257 (GRCm39) probably null Het
Nras T A 3: 102,966,350 (GRCm39) probably null Het
Nudt12 A G 17: 59,317,044 (GRCm39) V201A possibly damaging Het
Phf2 T C 13: 48,988,754 (GRCm39) E39G unknown Het
Serpinb3a A T 1: 106,975,291 (GRCm39) V172D probably damaging Het
Stab2 T A 10: 86,790,338 (GRCm39) probably null Het
Trim3 A G 7: 105,262,481 (GRCm39) I559T probably damaging Het
Trp53bp1 A T 2: 121,039,728 (GRCm39) S1304T possibly damaging Het
Xrcc5 A T 1: 72,385,485 (GRCm39) K525N probably benign Het
Zfp110 T A 7: 12,583,467 (GRCm39) V705D probably damaging Het
Other mutations in Grm7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01729:Grm7 APN 6 111,223,145 (GRCm39) missense probably benign 0.14
IGL02058:Grm7 APN 6 111,335,278 (GRCm39) missense probably damaging 1.00
IGL02650:Grm7 APN 6 111,335,919 (GRCm39) missense probably damaging 1.00
IGL02892:Grm7 APN 6 111,230,981 (GRCm39) missense probably damaging 0.99
IGL03074:Grm7 APN 6 111,472,604 (GRCm39) splice site probably null
IGL03185:Grm7 APN 6 110,623,183 (GRCm39) missense possibly damaging 0.84
Appropriated UTSW 6 111,472,642 (GRCm39) missense possibly damaging 0.64
Consumed UTSW 6 111,335,836 (GRCm39) missense probably damaging 1.00
Devoured UTSW 6 111,335,785 (GRCm39) missense probably damaging 1.00
Ravaged UTSW 6 111,335,874 (GRCm39) missense probably damaging 1.00
shaky UTSW 6 111,472,752 (GRCm39) nonsense probably null
PIT4651001:Grm7 UTSW 6 110,623,050 (GRCm39) missense probably benign
R0539:Grm7 UTSW 6 111,336,055 (GRCm39) splice site probably benign
R0622:Grm7 UTSW 6 111,335,457 (GRCm39) missense probably damaging 1.00
R1356:Grm7 UTSW 6 111,335,985 (GRCm39) missense probably damaging 1.00
R1762:Grm7 UTSW 6 111,335,256 (GRCm39) missense probably damaging 1.00
R1783:Grm7 UTSW 6 111,335,256 (GRCm39) missense probably damaging 1.00
R1785:Grm7 UTSW 6 111,335,256 (GRCm39) missense probably damaging 1.00
R1816:Grm7 UTSW 6 111,472,752 (GRCm39) nonsense probably null
R1823:Grm7 UTSW 6 111,184,730 (GRCm39) missense probably benign 0.17
R1864:Grm7 UTSW 6 111,057,384 (GRCm39) missense probably benign 0.03
R1894:Grm7 UTSW 6 111,335,568 (GRCm39) missense probably benign
R1987:Grm7 UTSW 6 110,891,472 (GRCm39) missense probably damaging 1.00
R1993:Grm7 UTSW 6 111,184,769 (GRCm39) missense probably benign 0.13
R2138:Grm7 UTSW 6 110,623,098 (GRCm39) missense probably damaging 1.00
R2214:Grm7 UTSW 6 111,335,958 (GRCm39) missense probably damaging 1.00
R2289:Grm7 UTSW 6 110,623,309 (GRCm39) missense probably damaging 1.00
R2339:Grm7 UTSW 6 111,472,642 (GRCm39) missense possibly damaging 0.64
R2847:Grm7 UTSW 6 110,623,309 (GRCm39) missense probably damaging 1.00
R2849:Grm7 UTSW 6 110,623,309 (GRCm39) missense probably damaging 1.00
R2879:Grm7 UTSW 6 110,623,309 (GRCm39) missense probably damaging 1.00
R2884:Grm7 UTSW 6 110,623,309 (GRCm39) missense probably damaging 1.00
R2921:Grm7 UTSW 6 111,472,866 (GRCm39) splice site probably null
R2923:Grm7 UTSW 6 111,472,866 (GRCm39) splice site probably null
R3014:Grm7 UTSW 6 110,623,309 (GRCm39) missense probably damaging 1.00
R3015:Grm7 UTSW 6 110,623,309 (GRCm39) missense probably damaging 1.00
R3703:Grm7 UTSW 6 110,623,309 (GRCm39) missense probably damaging 1.00
R3713:Grm7 UTSW 6 110,623,309 (GRCm39) missense probably damaging 1.00
R3963:Grm7 UTSW 6 110,623,309 (GRCm39) missense probably damaging 1.00
R4009:Grm7 UTSW 6 111,472,683 (GRCm39) missense probably damaging 1.00
R4091:Grm7 UTSW 6 110,891,301 (GRCm39) missense probably damaging 1.00
R4131:Grm7 UTSW 6 110,623,309 (GRCm39) missense probably damaging 1.00
R4132:Grm7 UTSW 6 110,623,309 (GRCm39) missense probably damaging 1.00
R4161:Grm7 UTSW 6 111,230,981 (GRCm39) missense probably damaging 0.99
R4329:Grm7 UTSW 6 110,891,325 (GRCm39) missense probably damaging 1.00
R4357:Grm7 UTSW 6 110,623,309 (GRCm39) missense probably damaging 1.00
R4359:Grm7 UTSW 6 110,623,309 (GRCm39) missense probably damaging 1.00
R4379:Grm7 UTSW 6 110,623,309 (GRCm39) missense probably damaging 1.00
R4379:Grm7 UTSW 6 111,223,335 (GRCm39) missense probably benign 0.05
R4380:Grm7 UTSW 6 110,623,309 (GRCm39) missense probably damaging 1.00
R4514:Grm7 UTSW 6 111,335,265 (GRCm39) missense possibly damaging 0.81
R4518:Grm7 UTSW 6 110,891,507 (GRCm39) splice site probably null
R4647:Grm7 UTSW 6 110,891,344 (GRCm39) nonsense probably null
R4714:Grm7 UTSW 6 111,057,383 (GRCm39) missense possibly damaging 0.52
R4775:Grm7 UTSW 6 110,891,332 (GRCm39) missense probably damaging 1.00
R4957:Grm7 UTSW 6 111,335,824 (GRCm39) missense probably damaging 1.00
R5056:Grm7 UTSW 6 111,057,404 (GRCm39) missense probably damaging 0.99
R5062:Grm7 UTSW 6 110,623,097 (GRCm39) missense probably damaging 1.00
R5256:Grm7 UTSW 6 111,335,182 (GRCm39) missense probably benign 0.01
R5431:Grm7 UTSW 6 111,335,387 (GRCm39) missense probably benign
R6026:Grm7 UTSW 6 111,478,500 (GRCm39) nonsense probably null
R6174:Grm7 UTSW 6 111,223,258 (GRCm39) missense probably benign
R6305:Grm7 UTSW 6 111,335,626 (GRCm39) missense probably damaging 1.00
R6318:Grm7 UTSW 6 111,335,836 (GRCm39) missense probably damaging 1.00
R6440:Grm7 UTSW 6 111,230,981 (GRCm39) missense probably damaging 1.00
R6519:Grm7 UTSW 6 111,184,713 (GRCm39) missense probably benign 0.00
R6531:Grm7 UTSW 6 111,335,386 (GRCm39) missense probably benign 0.29
R6888:Grm7 UTSW 6 111,335,314 (GRCm39) missense possibly damaging 0.79
R6949:Grm7 UTSW 6 111,472,690 (GRCm39) missense probably damaging 1.00
R6949:Grm7 UTSW 6 110,623,265 (GRCm39) missense probably benign 0.03
R6989:Grm7 UTSW 6 111,184,766 (GRCm39) missense probably damaging 1.00
R7076:Grm7 UTSW 6 111,335,113 (GRCm39) missense probably benign 0.04
R7203:Grm7 UTSW 6 111,335,530 (GRCm39) missense possibly damaging 0.94
R7208:Grm7 UTSW 6 111,335,530 (GRCm39) missense possibly damaging 0.94
R7217:Grm7 UTSW 6 111,335,785 (GRCm39) missense probably damaging 1.00
R7257:Grm7 UTSW 6 110,623,079 (GRCm39) missense probably damaging 1.00
R7297:Grm7 UTSW 6 110,622,974 (GRCm39) missense probably benign 0.16
R7470:Grm7 UTSW 6 111,478,476 (GRCm39) missense
R7567:Grm7 UTSW 6 111,335,722 (GRCm39) missense probably damaging 0.96
R7806:Grm7 UTSW 6 111,223,314 (GRCm39) nonsense probably null
R8018:Grm7 UTSW 6 111,184,737 (GRCm39) missense probably benign 0.01
R8076:Grm7 UTSW 6 111,543,000 (GRCm39) missense probably damaging 1.00
R8409:Grm7 UTSW 6 110,891,297 (GRCm39) missense probably benign 0.02
R8420:Grm7 UTSW 6 111,057,315 (GRCm39) missense probably benign
R8523:Grm7 UTSW 6 111,223,280 (GRCm39) missense possibly damaging 0.76
R8816:Grm7 UTSW 6 111,230,966 (GRCm39) missense possibly damaging 0.46
R8958:Grm7 UTSW 6 111,472,783 (GRCm39) missense probably damaging 0.96
R9135:Grm7 UTSW 6 111,472,729 (GRCm39) missense probably benign 0.39
R9207:Grm7 UTSW 6 111,335,874 (GRCm39) missense probably damaging 1.00
R9210:Grm7 UTSW 6 110,622,869 (GRCm39) missense probably benign 0.01
R9438:Grm7 UTSW 6 111,231,077 (GRCm39) missense possibly damaging 0.94
R9448:Grm7 UTSW 6 111,335,193 (GRCm39) missense probably benign 0.01
Z1176:Grm7 UTSW 6 111,335,451 (GRCm39) missense probably damaging 1.00
Z1176:Grm7 UTSW 6 111,335,110 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ATGCTCTCGACCAGATCAAC -3'
(R):5'- ATTCGACAGGATCTCCAGGG -3'

Sequencing Primer
(F):5'- TGCTGCCCAACGTAACG -3'
(R):5'- ATCTCCAGGGTAGAAATGTTGG -3'
Posted On 2014-10-30