Incidental Mutation 'R0279:Rbms1'
ID24522
Institutional Source Beutler Lab
Gene Symbol Rbms1
Ensembl Gene ENSMUSG00000026970
Gene NameRNA binding motif, single stranded interacting protein 1
SynonymsMSSP-1, 2600014B10Rik, YC1, MSSP-2, MSSP-3
MMRRC Submission 038501-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0279 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location60750193-60963192 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 60842410 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 44 (N44K)
Ref Sequence ENSEMBL: ENSMUSP00000131306 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028347] [ENSMUST00000112509] [ENSMUST00000164147]
Predicted Effect probably damaging
Transcript: ENSMUST00000028347
AA Change: N46K

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000028347
Gene: ENSMUSG00000026970
AA Change: N46K

DomainStartEndE-ValueType
low complexity region 7 24 N/A INTRINSIC
low complexity region 36 54 N/A INTRINSIC
RRM 63 131 4.56e-18 SMART
RRM 142 213 2.43e-13 SMART
Predicted Effect unknown
Transcript: ENSMUST00000112509
AA Change: N13K
SMART Domains Protein: ENSMUSP00000108128
Gene: ENSMUSG00000026970
AA Change: N13K

DomainStartEndE-ValueType
low complexity region 3 21 N/A INTRINSIC
RRM 30 98 4.56e-18 SMART
RRM 109 180 2.43e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132529
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151846
Predicted Effect probably damaging
Transcript: ENSMUST00000164147
AA Change: N44K

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000131306
Gene: ENSMUSG00000026970
AA Change: N44K

DomainStartEndE-ValueType
low complexity region 4 15 N/A INTRINSIC
low complexity region 34 52 N/A INTRINSIC
RRM 61 129 4.56e-18 SMART
RRM 140 211 2.43e-13 SMART
Meta Mutation Damage Score 0.092 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 95.1%
  • 20x: 89.6%
Validation Efficiency 99% (82/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a small family of proteins which bind single stranded DNA/RNA. These proteins are characterized by the presence of two sets of ribonucleoprotein consensus sequence (RNP-CS) that contain conserved motifs, RNP1 and RNP2, originally described in RNA binding proteins, and required for DNA binding. These proteins have been implicated in such diverse functions as DNA replication, gene transcription, cell cycle progression and apoptosis. Several transcript variants, resulting from alternative splicing and encoding different isoforms, have been described. A pseudogene for this locus is found on chromosome 12. [provided by RefSeq, Feb 2009]
PHENOTYPE: Only about half the expected number of mice homozygous for disruptions in this gene are produced in matings of heterozygotes. Embryo sizes are reduced. Females have smaller than normal uteri and decreased levels of progesterone during estrus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik T A 17: 56,885,169 Y577* probably null Het
2610528J11Rik A T 4: 118,529,293 M1L probably benign Het
5730596B20Rik T A 6: 52,179,202 probably benign Het
Acrbp T C 6: 125,053,954 probably null Het
Acss3 A G 10: 107,084,871 I126T possibly damaging Het
Aff3 T C 1: 38,535,569 E110G probably damaging Het
Aldh1a3 T C 7: 66,409,252 I113V probably benign Het
Aplp2 T C 9: 31,157,790 E525G probably damaging Het
Atp2b4 A G 1: 133,729,702 probably benign Het
Atp8a1 C T 5: 67,813,092 probably null Het
Bhmt A G 13: 93,625,464 C104R probably damaging Het
Ccdc151 A G 9: 21,990,247 probably benign Het
Cct5 T G 15: 31,591,031 E508A probably damaging Het
Celsr1 T A 15: 85,902,864 E2761D probably benign Het
Clstn1 T C 4: 149,643,674 S600P probably damaging Het
Cnppd1 A G 1: 75,136,929 S232P probably damaging Het
Crybb3 T C 5: 113,079,753 probably null Het
Csmd1 A G 8: 16,223,235 I861T probably damaging Het
Cyp2d10 A C 15: 82,405,339 S191A possibly damaging Het
Ddx10 T C 9: 53,235,304 D206G probably damaging Het
Dnah1 G T 14: 31,302,375 H916N possibly damaging Het
Dnah9 A G 11: 65,911,789 probably null Het
Epb42 G A 2: 121,029,044 probably benign Het
Etnppl A G 3: 130,629,413 R248G probably damaging Het
Eya3 T C 4: 132,719,247 F369L probably damaging Het
Fam129a T C 1: 151,709,206 probably null Het
Fam170b T C 14: 32,834,068 probably benign Het
Fli1 A T 9: 32,461,427 V105D probably damaging Het
Fmo1 T C 1: 162,830,272 I433M possibly damaging Het
Fndc3b C A 3: 27,457,006 C785F probably benign Het
Foxe3 T C 4: 114,925,568 D149G probably damaging Het
Gk5 T C 9: 96,174,804 probably benign Het
Gm14226 A G 2: 155,025,452 D443G possibly damaging Het
Gm9796 C T 11: 95,697,995 noncoding transcript Het
Golga4 A T 9: 118,568,993 R52S probably benign Het
Hey2 C A 10: 30,834,010 C249F probably damaging Het
Ipo9 A T 1: 135,420,363 probably benign Het
Ireb2 C A 9: 54,886,593 T269K probably benign Het
Kansl3 A G 1: 36,351,969 V274A probably damaging Het
Kcnk2 C T 1: 189,209,972 A352T possibly damaging Het
Lamc2 T C 1: 153,130,696 E903G probably benign Het
Lepr A G 4: 101,750,344 K253R probably benign Het
Lmntd2 T C 7: 141,213,623 probably benign Het
Lrrc39 A T 3: 116,578,303 T240S probably benign Het
Lrrc43 A G 5: 123,497,022 probably null Het
Maf T C 8: 115,705,756 M370V possibly damaging Het
Mib2 G A 4: 155,661,216 S46L possibly damaging Het
Mms22l C T 4: 24,497,867 T63I probably damaging Het
Morc2a T A 11: 3,683,989 S700R probably benign Het
Mpz A G 1: 171,159,929 probably benign Het
Ncam2 T C 16: 81,623,337 probably benign Het
Nudt14 C T 12: 112,938,417 A123T probably damaging Het
Olfr1016 A T 2: 85,799,535 I245N possibly damaging Het
Olfr13 G A 6: 43,174,758 M257I probably benign Het
Olfr239 C T 17: 33,199,324 T92I probably benign Het
Otoa T C 7: 121,111,079 probably benign Het
Pik3cg G A 12: 32,204,791 T399I probably damaging Het
Pkn3 C T 2: 30,083,297 A377V probably benign Het
Ppan A G 9: 20,891,529 N327S probably benign Het
Prkca T C 11: 108,054,111 probably benign Het
Prrc2c A T 1: 162,715,464 V320E probably damaging Het
Ptprq A G 10: 107,608,417 V1442A probably damaging Het
Rapgef1 C T 2: 29,726,227 R834C probably damaging Het
Rfwd3 A C 8: 111,282,733 F404V probably benign Het
Rimbp3 G T 16: 17,209,453 R247L probably benign Het
Serpinb1b T C 13: 33,093,713 S310P possibly damaging Het
Smtn C A 11: 3,530,235 V329L probably damaging Het
Snapc2 T C 8: 4,254,979 probably benign Het
Spam1 A T 6: 24,800,419 M386L probably benign Het
Syne2 A G 12: 76,095,613 E6208G probably damaging Het
Teddm1a T C 1: 153,892,623 Y278H probably damaging Het
Tnfaip6 A T 2: 52,055,916 N258I possibly damaging Het
Trpm4 C T 7: 45,322,048 R188Q probably damaging Het
Ttbk2 A T 2: 120,748,960 H491Q probably benign Het
Urgcp C T 11: 5,716,989 E450K probably benign Het
Vmn1r228 T C 17: 20,776,375 N294D probably benign Het
Wdfy3 A T 5: 101,868,092 C2606S probably damaging Het
Wdr33 T A 18: 31,888,324 H642Q unknown Het
Zbtb46 A G 2: 181,411,774 S382P possibly damaging Het
Zfp217 A G 2: 170,119,780 I209T probably benign Het
Zranb3 T A 1: 127,963,773 N822I probably benign Het
Other mutations in Rbms1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00813:Rbms1 APN 2 60797705 missense probably damaging 1.00
IGL01131:Rbms1 APN 2 60758836 missense probably benign 0.00
IGL02565:Rbms1 APN 2 60759779 missense probably benign
IGL02662:Rbms1 APN 2 60762306 missense probably damaging 1.00
ANU74:Rbms1 UTSW 2 60797716 missense probably damaging 1.00
R0077:Rbms1 UTSW 2 60758835 missense possibly damaging 0.48
R0718:Rbms1 UTSW 2 60842412 missense probably damaging 0.99
R1582:Rbms1 UTSW 2 60758835 missense possibly damaging 0.48
R2151:Rbms1 UTSW 2 60762048 splice site probably null
R4812:Rbms1 UTSW 2 60792769 missense possibly damaging 0.74
R5109:Rbms1 UTSW 2 60781940 missense probably damaging 1.00
R6925:Rbms1 UTSW 2 60762304 missense probably benign 0.03
R7513:Rbms1 UTSW 2 60758821 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCTATGATCAAGGAAGTCTTGGCAG -3'
(R):5'- AGCATCGTGCAGTGAATCTCATCC -3'

Sequencing Primer
(F):5'- CTTGGCAGCTAAGGCAAAGC -3'
(R):5'- TCACAGTAGCTGAGGATAATCTG -3'
Posted On2013-04-16