Incidental Mutation 'R2311:Postn'
ID245333
Institutional Source Beutler Lab
Gene Symbol Postn
Ensembl Gene ENSMUSG00000027750
Gene Nameperiostin, osteoblast specific factor
Synonymsperi, A630052E07Rik, OSF-2, Osf2, Periostin
MMRRC Submission 040310-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2311 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location54361109-54391037 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 54385223 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 737 (Y737F)
Ref Sequence ENSEMBL: ENSMUSP00000112735 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073012] [ENSMUST00000081564] [ENSMUST00000107985] [ENSMUST00000117373]
Predicted Effect possibly damaging
Transcript: ENSMUST00000073012
AA Change: Y737F

PolyPhen 2 Score 0.903 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000072773
Gene: ENSMUSG00000027750
AA Change: Y737F

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
FAS1 135 235 7.81e-30 SMART
FAS1 272 370 2.31e-32 SMART
FAS1 406 497 2.43e-17 SMART
FAS1 534 633 2.5e-28 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000081564
AA Change: Y764F

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000080276
Gene: ENSMUSG00000027750
AA Change: Y764F

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
FAS1 135 235 7.81e-30 SMART
FAS1 272 370 2.31e-32 SMART
FAS1 406 497 2.43e-17 SMART
FAS1 534 633 2.5e-28 SMART
low complexity region 669 680 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107985
AA Change: Y764F

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000103619
Gene: ENSMUSG00000027750
AA Change: Y764F

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
FAS1 135 235 7.81e-30 SMART
FAS1 272 370 2.31e-32 SMART
FAS1 406 497 2.43e-17 SMART
FAS1 534 633 2.5e-28 SMART
low complexity region 669 680 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000117373
AA Change: Y737F

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000112735
Gene: ENSMUSG00000027750
AA Change: Y737F

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
FAS1 135 235 7.81e-30 SMART
FAS1 272 370 2.31e-32 SMART
FAS1 406 497 2.43e-17 SMART
FAS1 534 633 2.5e-28 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127452
Predicted Effect probably benign
Transcript: ENSMUST00000143258
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145036
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150868
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154157
Meta Mutation Damage Score 0.154 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: This gene encodes a secreted extracellular matrix protein that functions in tissue development and regeneration, including wound healing and ventricular remodeling following myocardial infarction. The encoded protein binds to integrins to support adhesion and migration of epithelial cells. This protein plays a role in cancer stem cell maintenance and metastasis. Mice lacking this gene exhibit cardiac valve disease, and skeletal and dental defects. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous null mice display abnormalities of the enamel, periodontal ligament, ameloblasts, and incisors. For one allele changing the hardness of the food alters the severity of the abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apol7e G A 15: 77,718,036 R278H probably benign Het
Arhgef17 A G 7: 100,928,904 S946P probably benign Het
Capsl A T 15: 9,462,603 R110* probably null Het
Ddx41 G A 13: 55,534,480 R205W possibly damaging Het
Dock8 T A 19: 25,183,004 I1757N possibly damaging Het
Dthd1 T C 5: 62,839,237 probably benign Het
Eif5a2 A G 3: 28,782,176 E42G possibly damaging Het
Elovl3 A G 19: 46,133,200 S61G probably benign Het
Elp4 T C 2: 105,842,332 N136S probably benign Het
Elp6 A G 9: 110,320,818 S223G probably benign Het
Eml1 T A 12: 108,537,416 D743E probably damaging Het
Ezh2 T C 6: 47,558,260 Q85R probably damaging Het
Fermt3 C A 19: 7,014,162 C194F probably damaging Het
Flg A G 3: 93,292,953 probably benign Het
Gfi1b C T 2: 28,610,174 G282R probably damaging Het
Gm8979 T C 7: 106,083,590 K153E probably damaging Het
Gpr176 A T 2: 118,279,446 I444K probably benign Het
Gys2 A T 6: 142,463,244 M95K possibly damaging Het
Hgs C T 11: 120,479,648 R167W probably damaging Het
Map3k20 T C 2: 72,368,440 I130T probably damaging Het
Nckap5 A T 1: 126,528,752 Y25N probably damaging Het
Npc1 C T 18: 12,202,183 V629I probably benign Het
Nrl C A 14: 55,522,452 S6I probably damaging Het
Olfr1164 T C 2: 88,093,834 N34S probably benign Het
Olfr1209 T A 2: 88,909,469 D308V probably benign Het
Olfr1349 A T 7: 6,514,742 M229K probably benign Het
Oxct2b T C 4: 123,117,418 F377S probably damaging Het
Plb1 T C 5: 32,269,818 S91P probably benign Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Serpina1e T A 12: 103,951,129 I94F possibly damaging Het
Serpine2 A G 1: 79,810,548 probably benign Het
Stox2 T C 8: 47,191,978 R816G probably damaging Het
Tep1 T C 14: 50,833,567 N2092D possibly damaging Het
Tmem186 A G 16: 8,635,884 V171A probably benign Het
Trim58 G A 11: 58,643,108 V163M probably benign Het
Trim59 G T 3: 69,037,829 C59* probably null Het
Ulk1 C T 5: 110,789,357 R691Q probably benign Het
Vill A G 9: 119,065,897 N61S probably benign Het
Zer1 C T 2: 30,101,822 R662H probably damaging Het
Zfp644 A C 5: 106,634,956 V1184G probably benign Het
Zfp974 A G 7: 27,910,441 S620P possibly damaging Het
Other mutations in Postn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:Postn APN 3 54373728 missense probably damaging 1.00
IGL00567:Postn APN 3 54384523 missense probably benign
IGL00742:Postn APN 3 54372894 missense possibly damaging 0.81
IGL00971:Postn APN 3 54369276 missense possibly damaging 0.88
IGL01105:Postn APN 3 54362710 missense probably damaging 1.00
IGL01460:Postn APN 3 54375158 unclassified probably benign
IGL01609:Postn APN 3 54369228 missense probably damaging 0.99
IGL01878:Postn APN 3 54383480 splice site probably null
IGL01885:Postn APN 3 54376034 unclassified probably benign
IGL02040:Postn APN 3 54362689 missense probably benign
IGL02431:Postn APN 3 54375096 missense probably damaging 0.99
IGL02578:Postn APN 3 54377204 missense possibly damaging 0.93
IGL02943:Postn APN 3 54377608 critical splice donor site probably null
IGL03307:Postn APN 3 54375127 missense probably benign 0.32
sticklike UTSW 3 54372106 missense probably damaging 1.00
R0117:Postn UTSW 3 54383481 splice site probably benign
R0270:Postn UTSW 3 54384550 missense probably damaging 0.98
R0410:Postn UTSW 3 54385277 missense possibly damaging 0.93
R0548:Postn UTSW 3 54367576 nonsense probably null
R0734:Postn UTSW 3 54362715 missense probably damaging 1.00
R1648:Postn UTSW 3 54376101 missense probably damaging 1.00
R1796:Postn UTSW 3 54373756 missense probably damaging 1.00
R1823:Postn UTSW 3 54385287 critical splice donor site probably null
R1938:Postn UTSW 3 54377612 splice site probably null
R2566:Postn UTSW 3 54376953 missense probably damaging 0.97
R2938:Postn UTSW 3 54370310 missense probably damaging 1.00
R4105:Postn UTSW 3 54376041 missense probably damaging 1.00
R4394:Postn UTSW 3 54370955 missense probably damaging 1.00
R4620:Postn UTSW 3 54376993 missense probably damaging 1.00
R4628:Postn UTSW 3 54372157 missense probably damaging 1.00
R4697:Postn UTSW 3 54375071 missense probably damaging 1.00
R4709:Postn UTSW 3 54384610 intron probably benign
R4952:Postn UTSW 3 54390315 utr 3 prime probably benign
R5303:Postn UTSW 3 54377597 missense probably damaging 1.00
R5704:Postn UTSW 3 54372106 missense probably damaging 1.00
R5902:Postn UTSW 3 54372089 missense probably benign 0.03
R5914:Postn UTSW 3 54373800 nonsense probably null
R6032:Postn UTSW 3 54376716 missense possibly damaging 0.53
R6032:Postn UTSW 3 54376716 missense possibly damaging 0.53
R6101:Postn UTSW 3 54372220 splice site probably null
R6105:Postn UTSW 3 54372220 splice site probably null
R6334:Postn UTSW 3 54385282 missense probably benign
R7131:Postn UTSW 3 54362635 missense probably damaging 1.00
R7322:Postn UTSW 3 54370280 missense probably damaging 1.00
R7430:Postn UTSW 3 54370202 missense probably damaging 1.00
X0004:Postn UTSW 3 54362694 missense probably damaging 1.00
X0022:Postn UTSW 3 54370840 missense probably benign 0.03
Z1088:Postn UTSW 3 54375127 missense probably benign 0.32
Predicted Primers PCR Primer
(F):5'- CTTTGTGTGAGACTTACATCGATG -3'
(R):5'- TATGCTGGTGTGGAATATGAATCC -3'

Sequencing Primer
(F):5'- GTGAGACTTACATCGATGATTTAACC -3'
(R):5'- TGTGGAATATGAATCCTGGAGC -3'
Posted On2014-10-30