Incidental Mutation 'R2311:Npc1'
ID245361
Institutional Source Beutler Lab
Gene Symbol Npc1
Ensembl Gene ENSMUSG00000024413
Gene NameNPC intracellular cholesterol transporter 1
Synonymsnmf164, A430089E03Rik, D18Ertd723e, C85354, D18Ertd139e, lcsd
MMRRC Submission 040310-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.462) question?
Stock #R2311 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location12189693-12236400 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 12202183 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 629 (V629I)
Ref Sequence ENSEMBL: ENSMUSP00000025279 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025279]
Predicted Effect probably benign
Transcript: ENSMUST00000025279
AA Change: V629I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000025279
Gene: ENSMUSG00000024413
AA Change: V629I

DomainStartEndE-ValueType
low complexity region 8 15 N/A INTRINSIC
Pfam:NPC1_N 22 267 1.6e-79 PFAM
transmembrane domain 269 291 N/A INTRINSIC
transmembrane domain 353 375 N/A INTRINSIC
Pfam:Patched 436 896 3.5e-52 PFAM
Pfam:MMPL 648 794 6.3e-8 PFAM
Pfam:Sterol-sensing 649 803 2.7e-56 PFAM
Pfam:Patched 1023 1252 2.9e-33 PFAM
low complexity region 1259 1273 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153352
Meta Mutation Damage Score 0.1336 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large protein that resides in the limiting membrane of endosomes and lysosomes and mediates intracellular cholesterol trafficking via binding of cholesterol to its N-terminal domain. It is predicted to have a cytoplasmic C-terminus, 13 transmembrane domains, and 3 large loops in the lumen of the endosome - the last loop being at the N-terminus. This protein transports low-density lipoproteins to late endosomal/lysosomal compartments where they are hydrolized and released as free cholesterol. Defects in this gene cause Niemann-Pick type C disease, a rare autosomal recessive neurodegenerative disorder characterized by over accumulation of cholesterol and glycosphingolipids in late endosomal/lysosomal compartments.[provided by RefSeq, Aug 2009]
PHENOTYPE: Homozygotes for spontaneous and chemically induced mutations may exhibit lysosomal storage of non-esterified cholesterol, neurodegeneration, ataxia, presence of foam cells, sterility, and shortened lifespan. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apol7e G A 15: 77,718,036 R278H probably benign Het
Arhgef17 A G 7: 100,928,904 S946P probably benign Het
Capsl A T 15: 9,462,603 R110* probably null Het
Ddx41 G A 13: 55,534,480 R205W possibly damaging Het
Dock8 T A 19: 25,183,004 I1757N possibly damaging Het
Dthd1 T C 5: 62,839,237 probably benign Het
Eif5a2 A G 3: 28,782,176 E42G possibly damaging Het
Elovl3 A G 19: 46,133,200 S61G probably benign Het
Elp4 T C 2: 105,842,332 N136S probably benign Het
Elp6 A G 9: 110,320,818 S223G probably benign Het
Eml1 T A 12: 108,537,416 D743E probably damaging Het
Ezh2 T C 6: 47,558,260 Q85R probably damaging Het
Fermt3 C A 19: 7,014,162 C194F probably damaging Het
Flg A G 3: 93,292,953 probably benign Het
Gfi1b C T 2: 28,610,174 G282R probably damaging Het
Gm8979 T C 7: 106,083,590 K153E probably damaging Het
Gpr176 A T 2: 118,279,446 I444K probably benign Het
Gys2 A T 6: 142,463,244 M95K possibly damaging Het
Hgs C T 11: 120,479,648 R167W probably damaging Het
Map3k20 T C 2: 72,368,440 I130T probably damaging Het
Nckap5 A T 1: 126,528,752 Y25N probably damaging Het
Nrl C A 14: 55,522,452 S6I probably damaging Het
Olfr1164 T C 2: 88,093,834 N34S probably benign Het
Olfr1209 T A 2: 88,909,469 D308V probably benign Het
Olfr1349 A T 7: 6,514,742 M229K probably benign Het
Oxct2b T C 4: 123,117,418 F377S probably damaging Het
Plb1 T C 5: 32,269,818 S91P probably benign Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Postn A T 3: 54,385,223 Y737F probably damaging Het
Serpina1e T A 12: 103,951,129 I94F possibly damaging Het
Serpine2 A G 1: 79,810,548 probably benign Het
Stox2 T C 8: 47,191,978 R816G probably damaging Het
Tep1 T C 14: 50,833,567 N2092D possibly damaging Het
Tmem186 A G 16: 8,635,884 V171A probably benign Het
Trim58 G A 11: 58,643,108 V163M probably benign Het
Trim59 G T 3: 69,037,829 C59* probably null Het
Ulk1 C T 5: 110,789,357 R691Q probably benign Het
Vill A G 9: 119,065,897 N61S probably benign Het
Zer1 C T 2: 30,101,822 R662H probably damaging Het
Zfp644 A C 5: 106,634,956 V1184G probably benign Het
Zfp974 A G 7: 27,910,441 S620P possibly damaging Het
Other mutations in Npc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02347:Npc1 APN 18 12199634 missense probably benign 0.45
IGL02523:Npc1 APN 18 12201572 missense probably benign 0.00
IGL03018:Npc1 APN 18 12214379 missense probably damaging 0.99
IGL03101:Npc1 APN 18 12198539 missense probably benign 0.15
IGL03151:Npc1 APN 18 12219275 missense probably benign 0.05
IGL03377:Npc1 APN 18 12211821 missense probably benign
PIT4354001:Npc1 UTSW 18 12211535 missense probably benign 0.00
R0068:Npc1 UTSW 18 12208367 missense probably benign 0.04
R0068:Npc1 UTSW 18 12208367 missense probably benign 0.04
R0190:Npc1 UTSW 18 12191830 missense probably damaging 1.00
R0200:Npc1 UTSW 18 12219204 missense probably damaging 1.00
R0485:Npc1 UTSW 18 12213446 missense probably benign 0.00
R0699:Npc1 UTSW 18 12210575 missense probably benign 0.00
R0730:Npc1 UTSW 18 12219325 missense probably benign 0.00
R1302:Npc1 UTSW 18 12195085 missense probably benign 0.00
R1442:Npc1 UTSW 18 12195049 missense probably benign
R1463:Npc1 UTSW 18 12191830 missense probably damaging 1.00
R1804:Npc1 UTSW 18 12223088 missense probably damaging 1.00
R1808:Npc1 UTSW 18 12194092 missense probably damaging 1.00
R1928:Npc1 UTSW 18 12213378 missense possibly damaging 0.79
R2112:Npc1 UTSW 18 12213472 missense possibly damaging 0.49
R2117:Npc1 UTSW 18 12196556 missense probably damaging 1.00
R2157:Npc1 UTSW 18 12191809 missense probably damaging 0.98
R2279:Npc1 UTSW 18 12197179 splice site probably null
R2446:Npc1 UTSW 18 12214339 missense probably benign 0.01
R3004:Npc1 UTSW 18 12197254 missense probably benign 0.03
R4090:Npc1 UTSW 18 12198162 splice site probably null
R4304:Npc1 UTSW 18 12210527 missense possibly damaging 0.77
R4308:Npc1 UTSW 18 12210527 missense possibly damaging 0.77
R4564:Npc1 UTSW 18 12191732 missense probably damaging 1.00
R4786:Npc1 UTSW 18 12199497 missense probably benign 0.35
R5243:Npc1 UTSW 18 12198631 intron probably benign
R5404:Npc1 UTSW 18 12213299 missense possibly damaging 0.79
R5823:Npc1 UTSW 18 12191789 missense possibly damaging 0.69
R6080:Npc1 UTSW 18 12219351 missense probably damaging 1.00
R6215:Npc1 UTSW 18 12236192 small deletion probably benign
R6301:Npc1 UTSW 18 12197245 missense probably benign 0.00
R6476:Npc1 UTSW 18 12201694 nonsense probably null
R7007:Npc1 UTSW 18 12210548 missense probably benign 0.02
R7020:Npc1 UTSW 18 12198537 missense probably damaging 1.00
R7048:Npc1 UTSW 18 12204765 splice site probably null
R7116:Npc1 UTSW 18 12211544 missense probably damaging 1.00
R7153:Npc1 UTSW 18 12213291 missense possibly damaging 0.78
R7359:Npc1 UTSW 18 12195180 missense probably benign 0.05
R7382:Npc1 UTSW 18 12201706 missense probably damaging 0.99
X0012:Npc1 UTSW 18 12193311 unclassified probably null
Predicted Primers PCR Primer
(F):5'- CAAAGTTCCTGCACTTCCGG -3'
(R):5'- TCGAAACACTCCTCTAGCCTG -3'

Sequencing Primer
(F):5'- ACTTCCGGGTCCTGGAATG -3'
(R):5'- GAATCCAAATCTGACCATTTC -3'
Posted On2014-10-30