Incidental Mutation 'R2313:Ppp4c'
ID245376
Institutional Source Beutler Lab
Gene Symbol Ppp4c
Ensembl Gene ENSMUSG00000030697
Gene Nameprotein phosphatase 4, catalytic subunit
Synonyms1110002D08Rik, PPX
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2313 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location126785866-126792496 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 126787457 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 153 (S153P)
Ref Sequence ENSEMBL: ENSMUSP00000146245 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032936] [ENSMUST00000094037] [ENSMUST00000172352] [ENSMUST00000205786] [ENSMUST00000205935] [ENSMUST00000206353] [ENSMUST00000206570]
Predicted Effect probably damaging
Transcript: ENSMUST00000032936
AA Change: S153P

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000032936
Gene: ENSMUSG00000030697
AA Change: S153P

DomainStartEndE-ValueType
PP2Ac 20 290 4.04e-147 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000094037
SMART Domains Protein: ENSMUSP00000091579
Gene: ENSMUSG00000030699

DomainStartEndE-ValueType
low complexity region 55 75 N/A INTRINSIC
TBOX 90 278 1.79e-128 SMART
low complexity region 332 348 N/A INTRINSIC
low complexity region 414 428 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172352
SMART Domains Protein: ENSMUSP00000126418
Gene: ENSMUSG00000030699

DomainStartEndE-ValueType
low complexity region 55 75 N/A INTRINSIC
TBOX 90 278 1.79e-128 SMART
low complexity region 333 349 N/A INTRINSIC
low complexity region 415 429 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000205786
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205862
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205879
Predicted Effect probably benign
Transcript: ENSMUST00000205935
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205950
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206261
Predicted Effect probably benign
Transcript: ENSMUST00000206334
Predicted Effect probably benign
Transcript: ENSMUST00000206353
Predicted Effect probably benign
Transcript: ENSMUST00000206477
Predicted Effect probably damaging
Transcript: ENSMUST00000206570
AA Change: S153P

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Embryonic Ppp4c-deficiency leads to early embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alox5 T A 6: 116,413,861 D443V probably benign Het
Ankrd53 A T 6: 83,763,680 H95L probably damaging Het
Chrnb3 A G 8: 27,393,781 Y182C probably damaging Het
Cln5 C T 14: 103,071,746 R79* probably null Het
Cntn3 C A 6: 102,203,928 V769L probably benign Het
Gpat4 G A 8: 23,180,155 P286L probably damaging Het
Il1r1 T C 1: 40,313,310 S550P probably benign Het
Klra7 T A 6: 130,228,542 T132S probably benign Het
Lrch3 A G 16: 32,961,675 N273S probably damaging Het
Lrriq3 A T 3: 155,164,023 R328S probably benign Het
Mpp2 T C 11: 102,062,072 E318G possibly damaging Het
Olfr1228 C A 2: 89,248,941 C239F probably damaging Het
Olfr732 G A 14: 50,281,974 S93F probably damaging Het
Pglyrp2 A T 17: 32,418,699 D118E probably damaging Het
Ptpn13 A G 5: 103,564,161 S1642G probably damaging Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Unc13d A G 11: 116,063,734 F1016S probably damaging Het
Vwa8 C G 14: 78,912,218 T140S probably damaging Het
Wdfy3 A G 5: 101,889,284 F2046L probably damaging Het
Zfp788 A G 7: 41,648,888 H316R probably damaging Het
Zfp994 T A 17: 22,201,285 I228F probably damaging Het
Other mutations in Ppp4c
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0030:Ppp4c UTSW 7 126788433 missense possibly damaging 0.93
R0601:Ppp4c UTSW 7 126787288 missense probably benign 0.01
R0602:Ppp4c UTSW 7 126789082 splice site probably benign
R1187:Ppp4c UTSW 7 126786200 missense probably benign 0.02
R1244:Ppp4c UTSW 7 126786280 missense probably damaging 0.96
R1346:Ppp4c UTSW 7 126792050 splice site probably benign
R1878:Ppp4c UTSW 7 126787607 missense probably damaging 1.00
R1892:Ppp4c UTSW 7 126786280 missense probably damaging 0.96
R2072:Ppp4c UTSW 7 126787348 critical splice acceptor site probably null
R2863:Ppp4c UTSW 7 126792100 missense probably damaging 0.98
R2865:Ppp4c UTSW 7 126792100 missense probably damaging 0.98
R3808:Ppp4c UTSW 7 126787327 missense probably damaging 1.00
R3809:Ppp4c UTSW 7 126787327 missense probably damaging 1.00
R4290:Ppp4c UTSW 7 126792059 critical splice donor site probably null
R4504:Ppp4c UTSW 7 126787465 missense probably damaging 1.00
R5001:Ppp4c UTSW 7 126787537 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCAATTGTCCGGATCTGGTCC -3'
(R):5'- GCTGAGTGAGGCTGATAGAC -3'

Sequencing Primer
(F):5'- GGATCTGGTCCAAGGTCTGG -3'
(R):5'- CTGAGTGAGGCTGATAGACAATTG -3'
Posted On2014-10-30