Incidental Mutation 'R2316:C77080'
ID245481
Institutional Source Beutler Lab
Gene Symbol C77080
Ensembl Gene ENSMUSG00000050390
Gene Nameexpressed sequence C77080
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.215) question?
Stock #R2316 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location129219578-129261404 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 129223747 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 375 (T375A)
Ref Sequence ENSEMBL: ENSMUSP00000095483 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052602] [ENSMUST00000097873] [ENSMUST00000106051] [ENSMUST00000106054] [ENSMUST00000145261] [ENSMUST00000146376]
Predicted Effect probably damaging
Transcript: ENSMUST00000052602
AA Change: T420A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000062395
Gene: ENSMUSG00000050390
AA Change: T420A

DomainStartEndE-ValueType
low complexity region 2 30 N/A INTRINSIC
low complexity region 39 80 N/A INTRINSIC
low complexity region 209 215 N/A INTRINSIC
low complexity region 273 286 N/A INTRINSIC
low complexity region 365 382 N/A INTRINSIC
low complexity region 393 418 N/A INTRINSIC
low complexity region 449 464 N/A INTRINSIC
low complexity region 492 499 N/A INTRINSIC
low complexity region 532 550 N/A INTRINSIC
low complexity region 555 588 N/A INTRINSIC
low complexity region 621 634 N/A INTRINSIC
low complexity region 657 690 N/A INTRINSIC
low complexity region 724 739 N/A INTRINSIC
low complexity region 743 773 N/A INTRINSIC
low complexity region 810 833 N/A INTRINSIC
low complexity region 916 930 N/A INTRINSIC
low complexity region 988 1020 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000097873
AA Change: T375A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000095483
Gene: ENSMUSG00000050390
AA Change: T375A

DomainStartEndE-ValueType
low complexity region 164 170 N/A INTRINSIC
low complexity region 228 241 N/A INTRINSIC
low complexity region 320 337 N/A INTRINSIC
low complexity region 348 373 N/A INTRINSIC
low complexity region 404 419 N/A INTRINSIC
low complexity region 447 454 N/A INTRINSIC
low complexity region 487 505 N/A INTRINSIC
low complexity region 510 543 N/A INTRINSIC
low complexity region 576 589 N/A INTRINSIC
low complexity region 612 645 N/A INTRINSIC
low complexity region 679 694 N/A INTRINSIC
low complexity region 698 728 N/A INTRINSIC
low complexity region 765 788 N/A INTRINSIC
low complexity region 871 885 N/A INTRINSIC
low complexity region 943 975 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000106051
AA Change: T363A

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000101666
Gene: ENSMUSG00000050390
AA Change: T363A

DomainStartEndE-ValueType
low complexity region 152 158 N/A INTRINSIC
low complexity region 216 229 N/A INTRINSIC
low complexity region 308 325 N/A INTRINSIC
low complexity region 336 361 N/A INTRINSIC
low complexity region 392 407 N/A INTRINSIC
low complexity region 435 442 N/A INTRINSIC
low complexity region 475 493 N/A INTRINSIC
low complexity region 498 531 N/A INTRINSIC
low complexity region 564 577 N/A INTRINSIC
low complexity region 600 633 N/A INTRINSIC
low complexity region 667 682 N/A INTRINSIC
low complexity region 686 716 N/A INTRINSIC
low complexity region 753 776 N/A INTRINSIC
low complexity region 859 873 N/A INTRINSIC
low complexity region 931 963 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106054
SMART Domains Protein: ENSMUSP00000101669
Gene: ENSMUSG00000028811

DomainStartEndE-ValueType
low complexity region 5 26 N/A INTRINSIC
Pfam:tRNA-synt_1b 67 358 1e-78 PFAM
Pfam:tRNA_bind 406 502 7.1e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145261
Predicted Effect probably benign
Transcript: ENSMUST00000146376
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563I02Rik A G 14: 60,096,070 probably benign Het
Acaca T C 11: 84,264,080 M987T probably benign Het
Acaca A G 11: 84,294,983 T115A possibly damaging Het
Aknad1 A T 3: 108,781,156 D600V probably damaging Het
Arfgef3 T A 10: 18,616,953 T1237S probably benign Het
Brd4 A T 17: 32,212,910 L660Q probably benign Het
Casp1 A G 9: 5,306,213 D366G possibly damaging Het
Casp8ap2 C A 4: 32,643,781 S951R probably benign Het
Chd9 A G 8: 91,051,128 E2589G probably damaging Het
Dchs1 T C 7: 105,764,204 T1135A possibly damaging Het
Dnhd1 T C 7: 105,674,421 V633A probably damaging Het
Dock6 G T 9: 21,839,677 H400Q probably damaging Het
Dzip1 A G 14: 118,901,540 F426L probably benign Het
Elovl4 A G 9: 83,780,773 S236P probably damaging Het
Emp1 T C 6: 135,380,125 F67S probably damaging Het
Garnl3 A G 2: 33,005,152 L635P probably damaging Het
Htr7 C A 19: 35,969,303 probably null Het
Kcnd3 A C 3: 105,669,126 S629R probably benign Het
Lrp2 T A 2: 69,491,847 I1913F possibly damaging Het
Med19 T A 2: 84,686,243 D208E probably benign Het
Mettl21c A T 1: 44,013,632 V75E probably damaging Het
Nsd1 A T 13: 55,233,966 R64S probably damaging Het
Olfr1513 A G 14: 52,349,938 I36T probably benign Het
Olfr469 T A 7: 107,822,800 Y223F probably benign Het
Olfr624 A T 7: 103,670,467 I188N probably damaging Het
Plat T A 8: 22,776,865 M291K probably benign Het
Psmb4 T C 3: 94,885,011 E200G probably benign Het
Reln T C 5: 22,154,956 Y190C probably benign Het
Rp1 A G 1: 4,345,640 S1750P probably damaging Het
Slc5a4a T A 10: 76,178,081 probably null Het
Sobp A T 10: 43,158,038 N97K possibly damaging Het
Stac3 T C 10: 127,503,360 probably null Het
Stat5b G T 11: 100,796,492 T436K probably damaging Het
Tas1r3 A T 4: 155,863,315 M7K probably benign Het
Tmem189 T A 2: 167,654,715 Q46L possibly damaging Het
Vps13b C T 15: 35,674,899 Q1722* probably null Het
Zfp677 A T 17: 21,397,320 Y213F probably benign Het
Other mutations in C77080
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01530:C77080 APN 4 129222796 unclassified probably null
IGL02654:C77080 APN 4 129222319 missense probably damaging 1.00
IGL02797:C77080 APN 4 129223311 missense probably damaging 0.99
IGL03231:C77080 APN 4 129223681 missense possibly damaging 0.73
IGL03134:C77080 UTSW 4 129222487 missense possibly damaging 0.53
R0078:C77080 UTSW 4 129227723 splice site probably null
R0418:C77080 UTSW 4 129223684 missense probably damaging 1.00
R1374:C77080 UTSW 4 129222289 missense possibly damaging 0.83
R1632:C77080 UTSW 4 129222666 missense possibly damaging 0.94
R1735:C77080 UTSW 4 129223577 missense probably damaging 1.00
R1970:C77080 UTSW 4 129226017 splice site probably benign
R2018:C77080 UTSW 4 129222355 missense probably damaging 0.96
R2157:C77080 UTSW 4 129224124 missense possibly damaging 0.76
R2201:C77080 UTSW 4 129222639 missense probably benign
R3751:C77080 UTSW 4 129224322 unclassified probably benign
R4648:C77080 UTSW 4 129221940 missense probably benign 0.00
R4790:C77080 UTSW 4 129223302 missense probably damaging 1.00
R4885:C77080 UTSW 4 129224445 missense probably damaging 1.00
R5217:C77080 UTSW 4 129222685 missense probably damaging 0.99
R5270:C77080 UTSW 4 129224212 missense possibly damaging 0.48
R5272:C77080 UTSW 4 129224212 missense possibly damaging 0.48
R5273:C77080 UTSW 4 129224212 missense possibly damaging 0.48
R5314:C77080 UTSW 4 129224212 missense possibly damaging 0.48
R5548:C77080 UTSW 4 129223980 frame shift probably null
R5752:C77080 UTSW 4 129223980 frame shift probably null
R5908:C77080 UTSW 4 129222148 missense probably damaging 0.98
R5960:C77080 UTSW 4 129222072 missense probably damaging 0.99
R7024:C77080 UTSW 4 129225408 missense probably null 0.73
Z1088:C77080 UTSW 4 129222298 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCTTACGCAGGGACACACTC -3'
(R):5'- ACTTGTCGAAGCTGATCCCG -3'

Sequencing Primer
(F):5'- ACTCCTGCCAGACAGCTG -3'
(R):5'- AAGCTGATCCCGCACGC -3'
Posted On2014-10-30