Incidental Mutation 'R2316:Olfr624'
ID245488
Institutional Source Beutler Lab
Gene Symbol Olfr624
Ensembl Gene ENSMUSG00000045780
Gene Nameolfactory receptor 624
SynonymsMOR4-2P, GA_x6K02T2PBJ9-6394126-6393197
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.215) question?
Stock #R2316 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location103665461-103671191 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 103670467 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 188 (I188N)
Ref Sequence ENSEMBL: ENSMUSP00000049938 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062144]
Predicted Effect probably damaging
Transcript: ENSMUST00000062144
AA Change: I188N

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000049938
Gene: ENSMUSG00000045780
AA Change: I188N

DomainStartEndE-ValueType
Pfam:7tm_4 27 306 3.3e-138 PFAM
Pfam:7tm_1 37 288 1.8e-19 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563I02Rik A G 14: 60,096,070 probably benign Het
Acaca T C 11: 84,264,080 M987T probably benign Het
Acaca A G 11: 84,294,983 T115A possibly damaging Het
Aknad1 A T 3: 108,781,156 D600V probably damaging Het
Arfgef3 T A 10: 18,616,953 T1237S probably benign Het
Brd4 A T 17: 32,212,910 L660Q probably benign Het
C77080 T C 4: 129,223,747 T375A probably damaging Het
Casp1 A G 9: 5,306,213 D366G possibly damaging Het
Casp8ap2 C A 4: 32,643,781 S951R probably benign Het
Chd9 A G 8: 91,051,128 E2589G probably damaging Het
Dchs1 T C 7: 105,764,204 T1135A possibly damaging Het
Dnhd1 T C 7: 105,674,421 V633A probably damaging Het
Dock6 G T 9: 21,839,677 H400Q probably damaging Het
Dzip1 A G 14: 118,901,540 F426L probably benign Het
Elovl4 A G 9: 83,780,773 S236P probably damaging Het
Emp1 T C 6: 135,380,125 F67S probably damaging Het
Garnl3 A G 2: 33,005,152 L635P probably damaging Het
Htr7 C A 19: 35,969,303 probably null Het
Kcnd3 A C 3: 105,669,126 S629R probably benign Het
Lrp2 T A 2: 69,491,847 I1913F possibly damaging Het
Med19 T A 2: 84,686,243 D208E probably benign Het
Mettl21c A T 1: 44,013,632 V75E probably damaging Het
Nsd1 A T 13: 55,233,966 R64S probably damaging Het
Olfr1513 A G 14: 52,349,938 I36T probably benign Het
Olfr469 T A 7: 107,822,800 Y223F probably benign Het
Plat T A 8: 22,776,865 M291K probably benign Het
Psmb4 T C 3: 94,885,011 E200G probably benign Het
Reln T C 5: 22,154,956 Y190C probably benign Het
Rp1 A G 1: 4,345,640 S1750P probably damaging Het
Slc5a4a T A 10: 76,178,081 probably null Het
Sobp A T 10: 43,158,038 N97K possibly damaging Het
Stac3 T C 10: 127,503,360 probably null Het
Stat5b G T 11: 100,796,492 T436K probably damaging Het
Tas1r3 A T 4: 155,863,315 M7K probably benign Het
Tmem189 T A 2: 167,654,715 Q46L possibly damaging Het
Vps13b C T 15: 35,674,899 Q1722* probably null Het
Zfp677 A T 17: 21,397,320 Y213F probably benign Het
Other mutations in Olfr624
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02419:Olfr624 APN 7 103670475 nonsense probably null
IGL02536:Olfr624 APN 7 103670957 missense possibly damaging 0.78
IGL02684:Olfr624 APN 7 103670384 missense probably benign 0.06
FR4548:Olfr624 UTSW 7 103670960 small insertion probably benign
FR4548:Olfr624 UTSW 7 103670967 nonsense probably null
FR4976:Olfr624 UTSW 7 103670966 small insertion probably benign
R0295:Olfr624 UTSW 7 103670311 missense probably damaging 1.00
R0518:Olfr624 UTSW 7 103670489 missense possibly damaging 0.56
R0521:Olfr624 UTSW 7 103670489 missense possibly damaging 0.56
R1352:Olfr624 UTSW 7 103670311 missense probably damaging 1.00
R1779:Olfr624 UTSW 7 103670638 missense probably benign 0.15
R1878:Olfr624 UTSW 7 103670182 missense probably damaging 1.00
R1965:Olfr624 UTSW 7 103670896 missense probably damaging 1.00
R2162:Olfr624 UTSW 7 103670872 missense possibly damaging 0.95
R3792:Olfr624 UTSW 7 103670146 missense probably damaging 1.00
R3848:Olfr624 UTSW 7 103670701 missense probably damaging 0.99
R4120:Olfr624 UTSW 7 103671014 missense probably benign
R4183:Olfr624 UTSW 7 103670971 missense possibly damaging 0.87
R4853:Olfr624 UTSW 7 103670803 missense probably damaging 1.00
R6351:Olfr624 UTSW 7 103670956 missense possibly damaging 0.50
X0026:Olfr624 UTSW 7 103670395 missense probably benign
Predicted Primers PCR Primer
(F):5'- CGGTGAACCATAGTCAGACC -3'
(R):5'- GCCATTTGCAACCCTCTACG -3'

Sequencing Primer
(F):5'- GTGAACCATAGTCAGACCAATAATG -3'
(R):5'- TATTCCTCCATCCTAACCAATGACAG -3'
Posted On2014-10-30