Incidental Mutation 'R2317:Pdcd6ip'
ID 245528
Institutional Source Beutler Lab
Gene Symbol Pdcd6ip
Ensembl Gene ENSMUSG00000032504
Gene Name programmed cell death 6 interacting protein
Synonyms AIP1, Alix
MMRRC Submission 040312-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2317 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 113480812-113537327 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 113501842 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 467 (D467G)
Ref Sequence ENSEMBL: ENSMUSP00000035086 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035086] [ENSMUST00000111861]
AlphaFold Q9WU78
Predicted Effect probably benign
Transcript: ENSMUST00000035086
AA Change: D467G

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000035086
Gene: ENSMUSG00000032504
AA Change: D467G

DomainStartEndE-ValueType
BRO1 3 382 1.99e-160 SMART
Pfam:ALIX_LYPXL_bnd 408 702 3.6e-91 PFAM
low complexity region 731 812 N/A INTRINSIC
Blast:BRO1 813 839 2e-11 BLAST
low complexity region 840 869 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111861
AA Change: D472G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000107492
Gene: ENSMUSG00000032504
AA Change: D472G

DomainStartEndE-ValueType
BRO1 3 387 3.46e-160 SMART
Pfam:ALIX_LYPXL_bnd 417 706 8.8e-96 PFAM
low complexity region 736 817 N/A INTRINSIC
Blast:BRO1 818 844 2e-11 BLAST
low complexity region 845 874 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135545
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that functions within the ESCRT pathway in the abscission stage of cytokinesis, in intralumenal endosomal vesicle formation, and in enveloped virus budding. Studies using mouse cells have shown that overexpression of this protein can block apoptosis. In addition, the product of this gene binds to the product of the PDCD6 gene, a protein required for apoptosis, in a calcium-dependent manner. This gene product also binds to endophilins, proteins that regulate membrane shape during endocytosis. Overexpression of this gene product and endophilins results in cytoplasmic vacuolization, which may be partly responsible for the protection against cell death. Several alternatively spliced transcript variants encoding different isoforms have been found for this gene. Related pseudogenes have been identified on chromosome 15. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for a knock-out allele show decreased body and brain size and exhibit structural defects in the epithelium of the choroid plexus and in the brain ependyma that culminate in excessive cell extrusion, enlargement of the lateral ventricles, and hydrocephalus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ccdc102a T C 8: 95,634,957 (GRCm39) D327G probably null Het
Cdh15 G A 8: 123,583,374 (GRCm39) R59H probably benign Het
Cfap126 A G 1: 170,953,700 (GRCm39) D134G possibly damaging Het
Cript T C 17: 87,335,139 (GRCm39) L19P probably benign Het
Cwf19l1 A C 19: 44,120,597 (GRCm39) L39V possibly damaging Het
Eif2b4 T C 5: 31,348,920 (GRCm39) probably null Het
Esp16 A G 17: 39,850,738 (GRCm39) N39S probably benign Het
Fbxo30 A G 10: 11,166,078 (GRCm39) N267D probably damaging Het
Gabra6 T C 11: 42,208,607 (GRCm39) probably null Het
Gp1ba A G 11: 70,531,473 (GRCm39) probably benign Het
Klf12 C T 14: 100,179,503 (GRCm39) R279Q probably benign Het
Lats1 C T 10: 7,567,540 (GRCm39) Q104* probably null Het
Myrfl A G 10: 116,675,289 (GRCm39) Y215H possibly damaging Het
Ncoa1 A G 12: 4,325,189 (GRCm39) I963T probably damaging Het
Neurod6 A G 6: 55,655,906 (GRCm39) Y244H probably damaging Het
Nodal T C 10: 61,254,212 (GRCm39) M45T possibly damaging Het
Nuggc A G 14: 65,861,591 (GRCm39) E479G possibly damaging Het
Pnmt C A 11: 98,277,677 (GRCm39) Q74K probably benign Het
Slc25a36 G A 9: 96,961,235 (GRCm39) T267I probably damaging Het
Slc35e3 A G 10: 117,580,804 (GRCm39) S167P probably damaging Het
Sprr2f C A 3: 92,273,390 (GRCm39) P63H unknown Het
Stt3a T C 9: 36,659,371 (GRCm39) I323V probably benign Het
Tedc2 A G 17: 24,435,358 (GRCm39) S344P probably benign Het
Unc13b A G 4: 43,245,514 (GRCm39) D3722G probably damaging Het
Zfp35 T C 18: 24,136,555 (GRCm39) Y300H probably damaging Het
Zfp959 A G 17: 56,204,326 (GRCm39) D121G possibly damaging Het
Other mutations in Pdcd6ip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Pdcd6ip APN 9 113,526,586 (GRCm39) missense possibly damaging 0.89
IGL00814:Pdcd6ip APN 9 113,516,721 (GRCm39) missense probably damaging 0.97
IGL01092:Pdcd6ip APN 9 113,509,249 (GRCm39) splice site probably benign
IGL01621:Pdcd6ip APN 9 113,514,490 (GRCm39) missense probably benign 0.03
IGL01781:Pdcd6ip APN 9 113,520,566 (GRCm39) missense probably damaging 1.00
IGL02158:Pdcd6ip APN 9 113,509,121 (GRCm39) nonsense probably null
IGL03136:Pdcd6ip APN 9 113,520,567 (GRCm39) missense probably damaging 1.00
IGL03137:Pdcd6ip APN 9 113,486,213 (GRCm39) missense possibly damaging 0.69
IGL03246:Pdcd6ip APN 9 113,507,485 (GRCm39) missense possibly damaging 0.93
R0230:Pdcd6ip UTSW 9 113,514,361 (GRCm39) splice site probably benign
R0284:Pdcd6ip UTSW 9 113,491,572 (GRCm39) missense probably damaging 1.00
R0862:Pdcd6ip UTSW 9 113,503,578 (GRCm39) splice site probably benign
R0864:Pdcd6ip UTSW 9 113,503,578 (GRCm39) splice site probably benign
R1025:Pdcd6ip UTSW 9 113,491,354 (GRCm39) missense probably damaging 1.00
R1687:Pdcd6ip UTSW 9 113,529,087 (GRCm39) missense probably damaging 1.00
R1699:Pdcd6ip UTSW 9 113,507,422 (GRCm39) missense probably damaging 1.00
R1957:Pdcd6ip UTSW 9 113,537,090 (GRCm39) missense probably damaging 1.00
R2698:Pdcd6ip UTSW 9 113,503,575 (GRCm39) splice site probably null
R4182:Pdcd6ip UTSW 9 113,529,078 (GRCm39) missense probably benign 0.00
R5154:Pdcd6ip UTSW 9 113,520,610 (GRCm39) missense probably damaging 1.00
R5229:Pdcd6ip UTSW 9 113,507,401 (GRCm39) missense probably damaging 0.99
R5391:Pdcd6ip UTSW 9 113,520,586 (GRCm39) missense probably damaging 1.00
R5972:Pdcd6ip UTSW 9 113,491,366 (GRCm39) missense probably benign 0.07
R6149:Pdcd6ip UTSW 9 113,488,939 (GRCm39) missense probably benign 0.03
R6406:Pdcd6ip UTSW 9 113,503,412 (GRCm39) missense possibly damaging 0.81
R6514:Pdcd6ip UTSW 9 113,518,762 (GRCm39) missense probably benign 0.43
R6869:Pdcd6ip UTSW 9 113,484,174 (GRCm39) missense unknown
R6888:Pdcd6ip UTSW 9 113,500,905 (GRCm39) missense probably benign 0.04
R7078:Pdcd6ip UTSW 9 113,488,953 (GRCm39) missense probably benign 0.01
R7683:Pdcd6ip UTSW 9 113,516,763 (GRCm39) missense probably damaging 1.00
R8260:Pdcd6ip UTSW 9 113,501,865 (GRCm39) missense probably benign 0.05
R8376:Pdcd6ip UTSW 9 113,518,684 (GRCm39) missense probably damaging 1.00
R8495:Pdcd6ip UTSW 9 113,518,775 (GRCm39) missense probably benign 0.23
R8926:Pdcd6ip UTSW 9 113,514,493 (GRCm39) missense probably benign 0.23
R9080:Pdcd6ip UTSW 9 113,520,624 (GRCm39) missense probably damaging 0.96
R9260:Pdcd6ip UTSW 9 113,526,572 (GRCm39) critical splice donor site probably null
R9315:Pdcd6ip UTSW 9 113,488,921 (GRCm39) missense possibly damaging 0.50
R9542:Pdcd6ip UTSW 9 113,520,589 (GRCm39) missense probably damaging 1.00
R9546:Pdcd6ip UTSW 9 113,484,174 (GRCm39) missense unknown
R9547:Pdcd6ip UTSW 9 113,484,174 (GRCm39) missense unknown
Z1177:Pdcd6ip UTSW 9 113,514,437 (GRCm39) missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- CTGGGTGTTCACTATTCATACACAG -3'
(R):5'- CTGTCATGTTGTAACTCAGATTTCTGC -3'

Sequencing Primer
(F):5'- GTGTTCACTATTCATACACAGCTAAG -3'
(R):5'- CTCTACATAGCAAGTTCTGGGCTAG -3'
Posted On 2014-10-30