Incidental Mutation 'R2317:Fbxo30'
ID245530
Institutional Source Beutler Lab
Gene Symbol Fbxo30
Ensembl Gene ENSMUSG00000047648
Gene NameF-box protein 30
SynonymsFbx30
MMRRC Submission 040312-MU
Accession Numbers

Ncbi RefSeq: NM_027968.3, NM_001168297.1; MGI: 1919115

Is this an essential gene? Probably non essential (E-score: 0.172) question?
Stock #R2317 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location11281330-11298052 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 11290334 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 267 (N267D)
Ref Sequence ENSEMBL: ENSMUSP00000117687 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070300] [ENSMUST00000129456]
Predicted Effect probably damaging
Transcript: ENSMUST00000070300
AA Change: N267D

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000068230
Gene: ENSMUSG00000047648
AA Change: N267D

DomainStartEndE-ValueType
Pfam:zf-TRAF_2 8 100 2.5e-42 PFAM
Pfam:F-box_4 610 725 1.6e-52 PFAM
Pfam:F-box 612 653 3e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000129456
AA Change: N267D

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000117687
Gene: ENSMUSG00000047648
AA Change: N267D

DomainStartEndE-ValueType
PDB:2YRE|A 1 88 6e-51 PDB
SCOP:d1k2fa_ 58 93 7e-3 SMART
Pfam:F-box 612 653 2.3e-7 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of the ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbxs class and it is upregulated in nasopharyngeal carcinoma. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(32) : Targeted(2) Gene trapped(30)

Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ccdc102a T C 8: 94,908,329 D327G probably null Het
Cdh15 G A 8: 122,856,635 R59H probably benign Het
Cfap126 A G 1: 171,126,131 D134G possibly damaging Het
Cript T C 17: 87,027,711 L19P probably benign Het
Cwf19l1 A C 19: 44,132,158 L39V possibly damaging Het
Eif2b4 T C 5: 31,191,576 probably null Het
Esp16 A G 17: 39,539,847 N39S probably benign Het
Gabra6 T C 11: 42,317,780 probably null Het
Gp1ba A G 11: 70,640,647 probably benign Het
Klf12 C T 14: 99,942,067 R279Q probably benign Het
Lats1 C T 10: 7,691,776 Q104* probably null Het
Myrfl A G 10: 116,839,384 Y215H possibly damaging Het
Ncoa1 A G 12: 4,275,189 I963T probably damaging Het
Neurod6 A G 6: 55,678,921 Y244H probably damaging Het
Nodal T C 10: 61,418,433 M45T possibly damaging Het
Nuggc A G 14: 65,624,142 E479G possibly damaging Het
Pdcd6ip T C 9: 113,672,774 D467G probably benign Het
Pnmt C A 11: 98,386,851 Q74K probably benign Het
Slc25a36 G A 9: 97,079,182 T267I probably damaging Het
Slc35e3 A G 10: 117,744,899 S167P probably damaging Het
Sprr2f C A 3: 92,366,083 P63H unknown Het
Stt3a T C 9: 36,748,075 I323V probably benign Het
Tedc2 A G 17: 24,216,384 S344P probably benign Het
Unc13b A G 4: 43,245,514 D3722G probably damaging Het
Zfp35 T C 18: 24,003,498 Y300H probably damaging Het
Zfp959 A G 17: 55,897,326 D121G possibly damaging Het
Other mutations in Fbxo30
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00914:Fbxo30 APN 10 11290539 missense probably benign 0.01
IGL00971:Fbxo30 APN 10 11290298 missense probably benign
IGL02388:Fbxo30 APN 10 11290378 missense probably benign 0.01
PIT4468001:Fbxo30 UTSW 10 11290956 missense possibly damaging 0.95
R0014:Fbxo30 UTSW 10 11289859 nonsense probably null
R0144:Fbxo30 UTSW 10 11295220 missense probably damaging 1.00
R0709:Fbxo30 UTSW 10 11291313 missense possibly damaging 0.79
R1583:Fbxo30 UTSW 10 11291374 missense possibly damaging 0.67
R1791:Fbxo30 UTSW 10 11289787 nonsense probably null
R2018:Fbxo30 UTSW 10 11291028 missense probably damaging 0.98
R3842:Fbxo30 UTSW 10 11290112 missense probably damaging 0.98
R4579:Fbxo30 UTSW 10 11289549 missense probably benign 0.00
R4655:Fbxo30 UTSW 10 11291093 missense probably damaging 1.00
R4751:Fbxo30 UTSW 10 11290195 missense probably benign 0.01
R4998:Fbxo30 UTSW 10 11290763 missense probably damaging 0.98
R5325:Fbxo30 UTSW 10 11291102 missense possibly damaging 0.89
R5463:Fbxo30 UTSW 10 11291069 missense probably damaging 1.00
R5534:Fbxo30 UTSW 10 11289665 missense possibly damaging 0.91
R5594:Fbxo30 UTSW 10 11290479 missense probably benign 0.13
R5757:Fbxo30 UTSW 10 11290421 missense probably benign 0.08
R5917:Fbxo30 UTSW 10 11289518 critical splice acceptor site probably null
R6232:Fbxo30 UTSW 10 11289858 missense possibly damaging 0.90
R6472:Fbxo30 UTSW 10 11291231 missense probably damaging 1.00
R6677:Fbxo30 UTSW 10 11290636 missense possibly damaging 0.61
R6802:Fbxo30 UTSW 10 11291480 missense probably damaging 1.00
R7128:Fbxo30 UTSW 10 11290116 nonsense probably null
X0012:Fbxo30 UTSW 10 11290466 missense probably benign 0.00
X0066:Fbxo30 UTSW 10 11290812 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGCTGCTGCTTTAGATATCC -3'
(R):5'- TTCTGAAGTACCATCAGCTTCC -3'

Sequencing Primer
(F):5'- TTCTGCCACAAGAGACATTGG -3'
(R):5'- AGCTTCCACACAATCTCCATTTG -3'
Posted On2014-10-30