Incidental Mutation 'R2317:Ncoa1'
ID245537
Institutional Source Beutler Lab
Gene Symbol Ncoa1
Ensembl Gene ENSMUSG00000020647
Gene Namenuclear receptor coactivator 1
SynonymsbHLHe74, SRC-a/NCoA-1, KAT13A, SRC-1, SRC1, steroid receptor coactivator-1
MMRRC Submission 040312-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2317 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location4247362-4477182 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 4275189 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 963 (I963T)
Ref Sequence ENSEMBL: ENSMUSP00000151358 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085814] [ENSMUST00000217674] [ENSMUST00000217794] [ENSMUST00000220434]
Predicted Effect probably damaging
Transcript: ENSMUST00000085814
AA Change: I963T

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000082971
Gene: ENSMUSG00000020647
AA Change: I963T

DomainStartEndE-ValueType
HLH 29 86 1.73e-9 SMART
PAS 111 178 1.32e-10 SMART
Pfam:PAS_11 259 370 8e-37 PFAM
low complexity region 419 441 N/A INTRINSIC
Pfam:NCOA_u2 468 591 1.3e-29 PFAM
Pfam:SRC-1 632 712 3.5e-26 PFAM
low complexity region 724 736 N/A INTRINSIC
PDB:3RVF|B 747 767 1e-6 PDB
low complexity region 777 785 N/A INTRINSIC
low complexity region 869 880 N/A INTRINSIC
Pfam:Nuc_rec_co-act 930 977 2.3e-23 PFAM
low complexity region 1059 1080 N/A INTRINSIC
low complexity region 1125 1137 N/A INTRINSIC
DUF1518 1155 1211 7.47e-16 SMART
DUF1518 1218 1274 1.14e-11 SMART
low complexity region 1303 1315 N/A INTRINSIC
low complexity region 1333 1354 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000217674
AA Change: I852T

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000217794
AA Change: I963T

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect probably benign
Transcript: ENSMUST00000218191
Predicted Effect probably damaging
Transcript: ENSMUST00000220434
AA Change: I963T

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene acts as a transcriptional coactivator for steroid and nuclear hormone receptors. It is a member of the p160/steroid receptor coactivator (SRC) family and like other family members has histone acetyltransferase activity and contains a nuclear localization signal, as well as bHLH and PAS domains. The product of this gene binds nuclear receptors directly and stimulates the transcriptional activities in a hormone-dependent fashion. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a null allele show osteopenia, increased serum sex hormone levels, altered bone remodeling and skeletal responses to sex hormones, and obesity. Homozygotes for another null allele show thyroid and steroid hormone resistance, delayed Purkinje cell development, and behavioral deficits. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ccdc102a T C 8: 94,908,329 D327G probably null Het
Cdh15 G A 8: 122,856,635 R59H probably benign Het
Cfap126 A G 1: 171,126,131 D134G possibly damaging Het
Cript T C 17: 87,027,711 L19P probably benign Het
Cwf19l1 A C 19: 44,132,158 L39V possibly damaging Het
Eif2b4 T C 5: 31,191,576 probably null Het
Esp16 A G 17: 39,539,847 N39S probably benign Het
Fbxo30 A G 10: 11,290,334 N267D probably damaging Het
Gabra6 T C 11: 42,317,780 probably null Het
Gp1ba A G 11: 70,640,647 probably benign Het
Klf12 C T 14: 99,942,067 R279Q probably benign Het
Lats1 C T 10: 7,691,776 Q104* probably null Het
Myrfl A G 10: 116,839,384 Y215H possibly damaging Het
Neurod6 A G 6: 55,678,921 Y244H probably damaging Het
Nodal T C 10: 61,418,433 M45T possibly damaging Het
Nuggc A G 14: 65,624,142 E479G possibly damaging Het
Pdcd6ip T C 9: 113,672,774 D467G probably benign Het
Pnmt C A 11: 98,386,851 Q74K probably benign Het
Slc25a36 G A 9: 97,079,182 T267I probably damaging Het
Slc35e3 A G 10: 117,744,899 S167P probably damaging Het
Sprr2f C A 3: 92,366,083 P63H unknown Het
Stt3a T C 9: 36,748,075 I323V probably benign Het
Tedc2 A G 17: 24,216,384 S344P probably benign Het
Unc13b A G 4: 43,245,514 D3722G probably damaging Het
Zfp35 T C 18: 24,003,498 Y300H probably damaging Het
Zfp959 A G 17: 55,897,326 D121G possibly damaging Het
Other mutations in Ncoa1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00598:Ncoa1 APN 12 4278218 missense probably benign
IGL01335:Ncoa1 APN 12 4297520 missense probably benign 0.31
IGL02111:Ncoa1 APN 12 4274944 start codon destroyed probably null
IGL02863:Ncoa1 APN 12 4297513 missense probably benign 0.00
IGL02967:Ncoa1 APN 12 4295294 missense probably damaging 1.00
IGL03007:Ncoa1 APN 12 4339114 missense possibly damaging 0.92
IGL03031:Ncoa1 APN 12 4274818 missense possibly damaging 0.76
IGL03048:Ncoa1 UTSW 12 4267922 missense probably damaging 0.96
IGL03147:Ncoa1 UTSW 12 4259342 missense probably damaging 1.00
PIT1430001:Ncoa1 UTSW 12 4323005 missense probably benign 0.19
PIT4402001:Ncoa1 UTSW 12 4294987 missense probably benign 0.00
R0002:Ncoa1 UTSW 12 4290885 missense probably benign 0.00
R0011:Ncoa1 UTSW 12 4322896 missense possibly damaging 0.94
R0389:Ncoa1 UTSW 12 4295976 missense probably benign 0.05
R0467:Ncoa1 UTSW 12 4267687 missense possibly damaging 0.49
R0480:Ncoa1 UTSW 12 4339105 missense probably damaging 1.00
R0541:Ncoa1 UTSW 12 4323033 missense probably damaging 1.00
R0671:Ncoa1 UTSW 12 4249758 splice site probably null
R1387:Ncoa1 UTSW 12 4274790 missense probably benign 0.01
R1426:Ncoa1 UTSW 12 4270737 splice site probably benign
R1538:Ncoa1 UTSW 12 4270748 missense possibly damaging 0.94
R1577:Ncoa1 UTSW 12 4295196 missense probably damaging 0.99
R1902:Ncoa1 UTSW 12 4339049 missense possibly damaging 0.78
R1905:Ncoa1 UTSW 12 4295433 missense probably damaging 1.00
R2026:Ncoa1 UTSW 12 4267647 missense probably benign 0.19
R2259:Ncoa1 UTSW 12 4315819 missense probably damaging 1.00
R3608:Ncoa1 UTSW 12 4278186 missense probably benign 0.00
R4042:Ncoa1 UTSW 12 4267871 missense probably damaging 0.99
R4688:Ncoa1 UTSW 12 4315781 missense probably benign 0.26
R4763:Ncoa1 UTSW 12 4275297 missense probably damaging 1.00
R4878:Ncoa1 UTSW 12 4275004 missense probably damaging 1.00
R5062:Ncoa1 UTSW 12 4259333 missense probably damaging 0.99
R5531:Ncoa1 UTSW 12 4253746 missense probably benign
R6393:Ncoa1 UTSW 12 4278181 missense probably benign 0.00
R6711:Ncoa1 UTSW 12 4322904 missense probably benign 0.26
R7066:Ncoa1 UTSW 12 4322934 missense possibly damaging 0.90
R7109:Ncoa1 UTSW 12 4322978 missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- TCCGCCTCCCTGTTAGAAAAG -3'
(R):5'- GCGTATGTGTTTGCATTCTTAAACC -3'

Sequencing Primer
(F):5'- GCCTCCCTGTTAGAAAAGAAGCC -3'
(R):5'- GTGTTTGCATTCTTAAACCTGAGTC -3'
Posted On2014-10-30