Incidental Mutation 'R2318:Sstr1'
ID 245565
Institutional Source Beutler Lab
Gene Symbol Sstr1
Ensembl Gene ENSMUSG00000035431
Gene Name somatostatin receptor 1
Synonyms Smstr1, Smstr-1, sst1
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R2318 (G1)
Quality Score 225
Status Not validated
Chromosome 12
Chromosomal Location 58258558-58261230 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 58259562 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 62 (S62T)
Ref Sequence ENSEMBL: ENSMUSP00000106299 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044299] [ENSMUST00000110671]
AlphaFold P30873
Predicted Effect possibly damaging
Transcript: ENSMUST00000044299
AA Change: S62T

PolyPhen 2 Score 0.770 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000037045
Gene: ENSMUSG00000035431
AA Change: S62T

DomainStartEndE-ValueType
low complexity region 8 20 N/A INTRINSIC
Pfam:7TM_GPCR_Srx 66 297 4.9e-8 PFAM
Pfam:7TM_GPCR_Srsx 69 338 2.7e-14 PFAM
Pfam:7tm_1 75 323 2.2e-65 PFAM
Pfam:7TM_GPCR_Srv 131 339 1.9e-11 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000110671
AA Change: S62T

PolyPhen 2 Score 0.770 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000106299
Gene: ENSMUSG00000035431
AA Change: S62T

DomainStartEndE-ValueType
low complexity region 8 20 N/A INTRINSIC
Pfam:7TM_GPCR_Srx 66 299 4.8e-8 PFAM
Pfam:7TM_GPCR_Srsx 69 338 2.7e-14 PFAM
Pfam:7tm_1 75 323 4.1e-70 PFAM
Pfam:7TM_GPCR_Srv 131 339 1.8e-11 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Somatostatins are peptide hormones that regulate diverse cellular functions such as neurotransmission, cell proliferation, and endocrine signaling as well as inhibiting the release of many hormones and other secretory proteins. Somatostatin has two active forms of 14 and 28 amino acids. The biological effects of somatostatins are mediated by a family of G-protein coupled somatostatin receptors that are expressed in a tissue-specific manner. The protein encoded by this gene is a member of the superfamily of somatostatin receptors having seven transmembrane segments. Somatostatin receptors form homodimers and heterodimers with other members of the superfamily as well as with other G-protein coupled receptors and receptor tyrosine kinases. This somatostatin receptor has greater affinity for somatostatin-14 than -28. [provided by RefSeq, Jul 2012]
PHENOTYPE: Homozygous null mice display abnormal eye electrophysiology. Mice homozygous for a second targeted mutation display hypoactivity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef10 G A 8: 14,978,855 (GRCm39) A41T probably damaging Het
Car15 T C 16: 17,654,463 (GRCm39) M158V probably benign Het
Cinp C A 12: 110,840,443 (GRCm39) W113L probably damaging Het
Col4a3 T A 1: 82,626,290 (GRCm39) probably null Het
Csnk2b T C 17: 35,337,037 (GRCm39) Y101C possibly damaging Het
Ddb1 C T 19: 10,603,992 (GRCm39) R900C probably damaging Het
Eif4g2 A G 7: 110,673,065 (GRCm39) F876L possibly damaging Het
F11 A G 8: 45,701,675 (GRCm39) S353P probably damaging Het
H4c4 A G 13: 23,765,739 (GRCm39) Y52C probably damaging Het
Mast1 T C 8: 85,647,754 (GRCm39) D540G probably damaging Het
Mis18bp1 C T 12: 65,187,617 (GRCm39) V829M possibly damaging Het
Mtus2 C T 5: 148,043,892 (GRCm39) R827* probably null Het
Nlrp9a G A 7: 26,273,277 (GRCm39) V860M probably damaging Het
Plod3 G C 5: 137,017,000 (GRCm39) A50P probably benign Het
Prr14l T C 5: 32,987,422 (GRCm39) E691G probably benign Het
Rad1 A G 15: 10,490,495 (GRCm39) N154S probably benign Het
Sanbr A G 11: 23,538,701 (GRCm39) Y66H probably damaging Het
Slc10a4-ps T C 5: 72,743,638 (GRCm39) T27A probably benign Het
Smc2 T C 4: 52,446,030 (GRCm39) S133P probably damaging Het
Thsd7a T C 6: 12,405,146 (GRCm39) Y766C probably damaging Het
Timm44 A G 8: 4,318,307 (GRCm39) V129A probably benign Het
Tinag T C 9: 76,952,693 (GRCm39) Y97C probably damaging Het
Tns2 C T 15: 102,017,369 (GRCm39) R281C probably damaging Het
Ubap2 A G 4: 41,251,542 (GRCm39) V30A probably damaging Het
Other mutations in Sstr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Sstr1 APN 12 58,259,536 (GRCm39) missense probably benign
IGL01975:Sstr1 APN 12 58,260,412 (GRCm39) missense probably benign 0.01
R0019:Sstr1 UTSW 12 58,259,935 (GRCm39) missense probably damaging 1.00
R0019:Sstr1 UTSW 12 58,259,935 (GRCm39) missense probably damaging 1.00
R0026:Sstr1 UTSW 12 58,259,644 (GRCm39) missense probably damaging 1.00
R0083:Sstr1 UTSW 12 58,260,528 (GRCm39) missense possibly damaging 0.85
R1218:Sstr1 UTSW 12 58,260,406 (GRCm39) missense possibly damaging 0.68
R1254:Sstr1 UTSW 12 58,260,108 (GRCm39) missense possibly damaging 0.93
R1815:Sstr1 UTSW 12 58,260,264 (GRCm39) missense possibly damaging 0.81
R4588:Sstr1 UTSW 12 58,260,417 (GRCm39) missense probably benign 0.00
R5041:Sstr1 UTSW 12 58,259,941 (GRCm39) missense possibly damaging 0.94
R6556:Sstr1 UTSW 12 58,260,478 (GRCm39) missense possibly damaging 0.94
R7332:Sstr1 UTSW 12 58,260,172 (GRCm39) missense probably damaging 1.00
R7342:Sstr1 UTSW 12 58,260,456 (GRCm39) missense possibly damaging 0.95
R7380:Sstr1 UTSW 12 58,260,066 (GRCm39) missense probably benign 0.01
R7452:Sstr1 UTSW 12 58,260,142 (GRCm39) missense probably damaging 1.00
R7873:Sstr1 UTSW 12 58,260,313 (GRCm39) missense probably damaging 1.00
R9036:Sstr1 UTSW 12 58,259,569 (GRCm39) missense possibly damaging 0.92
R9095:Sstr1 UTSW 12 58,259,620 (GRCm39) missense probably damaging 1.00
R9726:Sstr1 UTSW 12 58,259,484 (GRCm39) missense probably benign 0.03
Z1176:Sstr1 UTSW 12 58,260,312 (GRCm39) missense possibly damaging 0.72
Predicted Primers PCR Primer
(F):5'- CCACTTCAGCTGGGATGTTC -3'
(R):5'- ACATGTTGACCGCATCCACG -3'

Sequencing Primer
(F):5'- ATGTTCCCCAATGGCACCG -3'
(R):5'- CACCAGGCGGCAAAGTAGC -3'
Posted On 2014-10-30