Incidental Mutation 'R2319:Vpreb3'
ID 245589
Institutional Source Beutler Lab
Gene Symbol Vpreb3
Ensembl Gene ENSMUSG00000000903
Gene Name V-set pre-B cell surrogate light chain 3
Synonyms 8HS-20, Vpreb-3
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2319 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 75778891-75785491 bp(+) (GRCm39)
Type of Mutation unclassified
DNA Base Change (assembly) C to T at 75779056 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000151812 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000121151] [ENSMUST00000219979]
AlphaFold D3Z6J4
Predicted Effect noncoding transcript
Transcript: ENSMUST00000059658
SMART Domains Protein: ENSMUSP00000055979
Gene: ENSMUSG00000050157

DomainStartEndE-ValueType
Pfam:Il2rg 2 89 6.7e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000117331
Predicted Effect unknown
Transcript: ENSMUST00000121151
AA Change: A2V
SMART Domains Protein: ENSMUSP00000113205
Gene: ENSMUSG00000000903
AA Change: A2V

DomainStartEndE-ValueType
IGv 43 124 1.81e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000219979
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the human ortholog of the mouse VpreB3 (8HS20) protein, is thought to be involved in B-cell maturation, and may play a role in assembly of the pre-B cell receptor (pre-BCR). While the role of this protein in B-cell development has not yet been elucidated, studies with the chicken ortholog of this protein have found that when overexpressed, this protein localizes to the endoplasmic reticulum. The mouse ortholog of this protein has been shown to associate with membrane mu heavy chains early in the course of pre-B cell receptor biosynthesis. Expression of this gene has been observed in some lymphomas. [provided by RefSeq, Apr 2015]
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 C T 6: 128,557,349 (GRCm39) A115T probably benign Het
Atp11a T A 8: 12,897,505 (GRCm39) H273Q probably damaging Het
Ccdc186 A G 19: 56,785,999 (GRCm39) S679P possibly damaging Het
Chac2 T A 11: 30,936,252 (GRCm39) probably benign Het
Col6a5 T C 9: 105,814,417 (GRCm39) T532A unknown Het
Dsg1c A T 18: 20,408,235 (GRCm39) Y428F probably damaging Het
F11 A G 8: 45,701,675 (GRCm39) S353P probably damaging Het
Gm7489 A T 15: 53,748,445 (GRCm39) probably benign Het
Gnat3 T G 5: 18,224,624 (GRCm39) D341E probably benign Het
Lrpprc G A 17: 85,033,818 (GRCm39) P1020S probably benign Het
Niban3 T C 8: 72,055,408 (GRCm39) F273L probably benign Het
Nlrp4a A G 7: 26,149,319 (GRCm39) S309G probably benign Het
Pik3cg T C 12: 32,226,735 (GRCm39) I1051V probably damaging Het
Plod3 G C 5: 137,017,000 (GRCm39) A50P probably benign Het
Rmnd1 A G 10: 4,372,099 (GRCm39) V200A possibly damaging Het
Rrbp1 T C 2: 143,799,479 (GRCm39) N1076S probably benign Het
Rtn4 A G 11: 29,657,154 (GRCm39) D436G probably benign Het
Spta1 A G 1: 174,006,222 (GRCm39) probably null Het
Srsf3 G A 17: 29,257,520 (GRCm39) R88Q unknown Het
Stxbp2 T C 8: 3,683,834 (GRCm39) I90T possibly damaging Het
Tnr T A 1: 159,677,618 (GRCm39) M1K probably null Het
Tns3 G A 11: 8,491,200 (GRCm39) S119L probably damaging Het
Vmn1r2 A G 4: 3,172,083 (GRCm39) M1V probably null Het
Other mutations in Vpreb3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01743:Vpreb3 APN 10 75,784,231 (GRCm39) missense probably benign
IGL02051:Vpreb3 APN 10 75,784,244 (GRCm39) critical splice donor site probably null
IGL03162:Vpreb3 APN 10 75,785,133 (GRCm39) missense probably damaging 1.00
R2891:Vpreb3 UTSW 10 75,779,056 (GRCm39) unclassified probably benign
R2892:Vpreb3 UTSW 10 75,779,056 (GRCm39) unclassified probably benign
R2894:Vpreb3 UTSW 10 75,779,056 (GRCm39) unclassified probably benign
R3438:Vpreb3 UTSW 10 75,779,056 (GRCm39) unclassified probably benign
R3439:Vpreb3 UTSW 10 75,779,056 (GRCm39) unclassified probably benign
R3508:Vpreb3 UTSW 10 75,785,037 (GRCm39) missense probably benign 0.26
R3725:Vpreb3 UTSW 10 75,779,125 (GRCm39) critical splice donor site probably null
R3726:Vpreb3 UTSW 10 75,779,125 (GRCm39) critical splice donor site probably null
R3771:Vpreb3 UTSW 10 75,775,800 (GRCm39) missense probably benign 0.00
R4975:Vpreb3 UTSW 10 75,775,636 (GRCm39) missense probably damaging 1.00
Z1177:Vpreb3 UTSW 10 75,785,027 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGCCTTCCTTGAACAGCCC -3'
(R):5'- CAAGTATGCAACTGGGAAATACAC -3'

Sequencing Primer
(F):5'- TGAACAGCCCCCAGTTTG -3'
(R):5'- CTTTCCTATAAAGGGTGAGCACAC -3'
Posted On 2014-10-30