Incidental Mutation 'R2320:Cpxm1'
ID245603
Institutional Source Beutler Lab
Gene Symbol Cpxm1
Ensembl Gene ENSMUSG00000027408
Gene Namecarboxypeptidase X 1 (M14 family)
SynonymsCpx-1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.190) question?
Stock #R2320 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location130390775-130397574 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 130394211 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 344 (Y344H)
Ref Sequence ENSEMBL: ENSMUSP00000028897 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028897]
Predicted Effect probably damaging
Transcript: ENSMUST00000028897
AA Change: Y344H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028897
Gene: ENSMUSG00000027408
AA Change: Y344H

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 56 75 N/A INTRINSIC
FA58C 104 263 1.44e-28 SMART
Zn_pept 410 699 5.77e-50 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130533
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene likely encodes a member of the carboxypeptidase family of proteins. Cloning of a comparable locus in mouse indicates that the encoded protein contains a discoidin domain and a carboxypeptidase domain, but the protein appears to lack residues necessary for carboxypeptidase activity.[provided by RefSeq, May 2010]
Allele List at MGI
Other mutations in this stock
Total: 17 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anapc10 T C 8: 79,775,079 Y159H probably benign Het
Arid1a A T 4: 133,680,529 N2222K unknown Het
Itpr3 T C 17: 27,095,915 S679P probably benign Het
Macf1 T C 4: 123,439,495 T2376A probably benign Het
Med4 T A 14: 73,517,933 M227K possibly damaging Het
Ncan T C 8: 70,108,218 I700V probably benign Het
Olfr344 T A 2: 36,568,625 V9E possibly damaging Het
Pik3c2b A T 1: 133,103,413 S1486C probably damaging Het
Ralbp1 A G 17: 65,852,747 I507T possibly damaging Het
Rpl4 C T 9: 64,175,599 R100C probably damaging Het
Scn5a C A 9: 119,529,956 probably null Het
Serhl A G 15: 83,101,872 D2G probably damaging Het
Thbd T C 2: 148,406,646 E434G probably damaging Het
Trim17 T C 11: 58,966,798 Y152H probably benign Het
Vmn1r38 G A 6: 66,776,550 T194I possibly damaging Het
Wdhd1 C T 14: 47,274,028 V76I probably benign Het
Zfp709 T A 8: 71,887,292 V11E probably damaging Het
Other mutations in Cpxm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:Cpxm1 APN 2 130395943 missense probably damaging 1.00
IGL01327:Cpxm1 APN 2 130396357 missense probably benign 0.00
IGL01373:Cpxm1 APN 2 130394135 missense probably damaging 1.00
IGL01622:Cpxm1 APN 2 130391271 missense probably benign 0.00
IGL01623:Cpxm1 APN 2 130391271 missense probably benign 0.00
IGL01981:Cpxm1 APN 2 130394140 nonsense probably null
IGL02031:Cpxm1 APN 2 130393681 missense probably damaging 1.00
IGL02369:Cpxm1 APN 2 130396424 missense probably damaging 1.00
IGL03057:Cpxm1 APN 2 130393189 missense probably damaging 1.00
R0316:Cpxm1 UTSW 2 130393171 missense probably damaging 1.00
R0544:Cpxm1 UTSW 2 130393135 missense probably damaging 1.00
R0726:Cpxm1 UTSW 2 130390939 missense probably damaging 0.96
R0944:Cpxm1 UTSW 2 130397503 missense probably damaging 1.00
R1334:Cpxm1 UTSW 2 130393563 missense probably damaging 0.99
R1366:Cpxm1 UTSW 2 130396122 missense probably damaging 1.00
R1429:Cpxm1 UTSW 2 130396444 missense probably damaging 0.98
R1654:Cpxm1 UTSW 2 130393546 missense possibly damaging 0.51
R1824:Cpxm1 UTSW 2 130395697 missense probably damaging 0.99
R2144:Cpxm1 UTSW 2 130397410 missense probably benign 0.00
R2200:Cpxm1 UTSW 2 130393197 missense probably damaging 1.00
R2434:Cpxm1 UTSW 2 130394084 missense probably damaging 1.00
R3118:Cpxm1 UTSW 2 130393573 missense possibly damaging 0.80
R4601:Cpxm1 UTSW 2 130393576 missense possibly damaging 0.83
R5020:Cpxm1 UTSW 2 130395977 splice site probably null
R5041:Cpxm1 UTSW 2 130394070 missense probably damaging 1.00
R5727:Cpxm1 UTSW 2 130390963 nonsense probably null
R5806:Cpxm1 UTSW 2 130397473 missense probably damaging 1.00
R6660:Cpxm1 UTSW 2 130396149 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCAGTCTCATAGCCATCAG -3'
(R):5'- CTTCCCAGCTGATGAAACAGG -3'

Sequencing Primer
(F):5'- CTCATAGCCATCAGGATTCATGGAG -3'
(R):5'- CGCATCTACAGCATCGGGAAG -3'
Posted On2014-10-30