Mutagenetix > Incidental Mutation

Incidental Mutation 'R2320:Med4'

245617

Institutional Source

Beutler Lab

Gene Symbol

Med4

Ensembl Gene

ENSMUSG00000022109

Gene Name

mediator complex subunit 4

Synonyms

DRIP36, MED4, HSPC126, 2410046H15Rik, TRAP36, Vdrip, p36 TRAP/SMCC/PC2 subunit

Accession Numbers

Essential gene?

Probably essential (E-score: 0.962) question?

Stock #

R2320 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

73747489-73755985 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 73755373 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 227 (M227K)

Ref Sequence

ENSEMBL: ENSMUSP00000022705 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022705] [ENSMUST00000043813]

AlphaFold

Q9CQA5

Predicted Effect

possibly damaging
Transcript: ENSMUST00000022705
AA Change: M227K

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000022705
Gene: ENSMUSG00000022109
AA Change: M227K

Domain	Start	End	E-Value	Type
Pfam:Med4	63	206	7.8e-34	PFAM
low complexity region	259	270	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000043813

SMART Domains

Protein: ENSMUSP00000039537
Gene: ENSMUSG00000033405

Domain	Start	End	E-Value	Type
Pfam:NUDIX	11	142	1.5e-18	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000226903

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000228141

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the Mediator complex. The Mediator complex interacts with DNA-binding gene-specific transcription factors to modulate transcription by RNA polymerase II. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jul 2012]

Allele List at MGI

Other mutations in this stock

Total: 17 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Anapc10	T	C	8: 80,501,708 (GRCm39)	Y159H	probably benign	Het
Arid1a	A	T	4: 133,407,840 (GRCm39)	N2222K	unknown	Het
Cpxm1	A	G	2: 130,236,131 (GRCm39)	Y344H	probably damaging	Het
Itpr3	T	C	17: 27,314,889 (GRCm39)	S679P	probably benign	Het
Macf1	T	C	4: 123,333,288 (GRCm39)	T2376A	probably benign	Het
Ncan	T	C	8: 70,560,868 (GRCm39)	I700V	probably benign	Het
Or1j15	T	A	2: 36,458,637 (GRCm39)	V9E	possibly damaging	Het
Pik3c2b	A	T	1: 133,031,151 (GRCm39)	S1486C	probably damaging	Het
Ralbp1	A	G	17: 66,159,742 (GRCm39)	I507T	possibly damaging	Het
Rpl4	C	T	9: 64,082,881 (GRCm39)	R100C	probably damaging	Het
Scn5a	C	A	9: 119,359,022 (GRCm39)		probably null	Het
Serhl	A	G	15: 82,986,073 (GRCm39)	D2G	probably damaging	Het
Thbd	T	C	2: 148,248,566 (GRCm39)	E434G	probably damaging	Het
Trim17	T	C	11: 58,857,624 (GRCm39)	Y152H	probably benign	Het
Vmn1r38	G	A	6: 66,753,534 (GRCm39)	T194I	possibly damaging	Het
Wdhd1	C	T	14: 47,511,485 (GRCm39)	V76I	probably benign	Het
Zfp709	T	A	8: 72,641,136 (GRCm39)	V11E	probably damaging	Het

Other mutations in Med4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00556:Med4	APN	14	73,754,707 (GRCm39)	missense	probably damaging	1.00
IGL02728:Med4	APN	14	73,755,415 (GRCm39)	missense	possibly damaging	0.87
IGL02964:Med4	APN	14	73,755,361 (GRCm39)	missense	probably damaging	0.98
R0718:Med4	UTSW	14	73,754,097 (GRCm39)	missense	probably damaging	1.00
R2131:Med4	UTSW	14	73,755,436 (GRCm39)	missense	possibly damaging	0.82
R2156:Med4	UTSW	14	73,755,472 (GRCm39)	unclassified	probably benign
R4454:Med4	UTSW	14	73,755,502 (GRCm39)	unclassified	probably benign
R5361:Med4	UTSW	14	73,747,553 (GRCm39)	nonsense	probably null
R6419:Med4	UTSW	14	73,751,363 (GRCm39)	missense	probably damaging	1.00
R8461:Med4	UTSW	14	73,755,468 (GRCm39)	missense	unknown
R8724:Med4	UTSW	14	73,751,249 (GRCm39)	nonsense	probably null
R9172:Med4	UTSW	14	73,751,365 (GRCm39)	missense	probably benign	0.00
R9322:Med4	UTSW	14	73,747,601 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATCCCTAACCTTGTTAGATCCTTGG -3'
(R):5'- CCGCTGATTTTCATGGGCTC -3'

Sequencing Primer
(F):5'- CCTTGTTAGATCCTTGGTACTACAAG -3'
(R):5'- CGCTGATTTTCATGGGCTCCTTAG -3'

Posted On

2014-10-30