Incidental Mutation 'R2321:Tm9sf4'
ID245626
Institutional Source Beutler Lab
Gene Symbol Tm9sf4
Ensembl Gene ENSMUSG00000068040
Gene Nametransmembrane 9 superfamily protein member 4
Synonyms
MMRRC Submission 040313-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2321 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location153161303-153210466 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 153204586 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 582 (Y582N)
Ref Sequence ENSEMBL: ENSMUSP00000086422 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089027]
Predicted Effect probably damaging
Transcript: ENSMUST00000089027
AA Change: Y582N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000086422
Gene: ENSMUSG00000068040
AA Change: Y582N

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:EMP70 55 600 5.3e-203 PFAM
transmembrane domain 605 627 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134922
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137446
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145010
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149390
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152807
Meta Mutation Damage Score 0.536 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 100% (39/39)
MGI Phenotype PHENOTYPE: Homozygous mutants exhibit abnormal hair follicles and sebaceous glands, vertebrae and rib abnormalities, and increased circulating cholesterol, calcium, albumin, and total protein levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 C T 6: 128,580,386 A115T probably benign Het
Abcf2 A T 5: 24,567,253 Y492* probably null Het
Adcy9 A G 16: 4,288,268 V994A probably damaging Het
Arhgef40 T C 14: 51,994,276 probably benign Het
Bhlha15 T C 5: 144,191,196 L42P probably damaging Het
Clca4b C A 3: 144,932,373 A43S probably benign Het
Cpq A G 15: 33,594,145 H434R probably benign Het
Crybg2 A G 4: 134,074,511 E994G probably benign Het
Dcaf1 T C 9: 106,838,473 L263S probably benign Het
Dnajc12 G T 10: 63,407,211 probably benign Het
Fbxo32 T C 15: 58,191,293 I215V possibly damaging Het
Krtap17-1 T C 11: 99,993,920 D7G unknown Het
Men1 A G 19: 6,339,838 D466G possibly damaging Het
Myh15 T A 16: 49,113,073 F624I possibly damaging Het
Ncam1 A C 9: 49,544,832 probably benign Het
Olfr1389 A G 11: 49,431,280 N268S probably benign Het
Otol1 T A 3: 70,018,525 L11* probably null Het
Plekhg4 T C 8: 105,377,540 S447P probably benign Het
Pnmal2 G T 7: 16,945,565 R158L unknown Het
Ppp1r2 A T 16: 31,265,303 probably null Het
Rad51ap2 G A 12: 11,457,057 G327R probably damaging Het
Rbm26 T C 14: 105,153,427 T208A unknown Het
Reln T C 5: 21,915,020 Y2878C probably damaging Het
Rnps1 T A 17: 24,422,168 F181I probably damaging Het
Senp6 A C 9: 80,123,740 I575L possibly damaging Het
Serpinh1 T C 7: 99,346,385 D330G probably damaging Het
Slamf9 G T 1: 172,477,413 C198F probably damaging Het
Slc22a13 A T 9: 119,195,628 V261D possibly damaging Het
Slc26a4 A G 12: 31,540,544 V370A probably damaging Het
Tasp1 A G 2: 140,057,412 M7T probably benign Het
Tet2 T C 3: 133,486,339 N778S possibly damaging Het
Tmem131l T A 3: 83,936,023 H508L probably damaging Het
Tmem71 T G 15: 66,552,000 D139A possibly damaging Het
Uroc1 A G 6: 90,347,247 R418G possibly damaging Het
Wdr64 A C 1: 175,795,087 K810T possibly damaging Het
Zgrf1 C A 3: 127,562,407 Y427* probably null Het
Other mutations in Tm9sf4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00469:Tm9sf4 APN 2 153202355 missense probably damaging 1.00
IGL02218:Tm9sf4 APN 2 153204616 missense probably benign 0.00
IGL02354:Tm9sf4 APN 2 153187650 missense probably benign
IGL02361:Tm9sf4 APN 2 153187650 missense probably benign
IGL03047:Tm9sf4 UTSW 2 153161406 utr 5 prime probably benign
R0079:Tm9sf4 UTSW 2 153191145 missense probably damaging 1.00
R0147:Tm9sf4 UTSW 2 153195313 missense probably benign 0.01
R0650:Tm9sf4 UTSW 2 153187365 missense probably benign 0.00
R0729:Tm9sf4 UTSW 2 153191145 missense probably damaging 1.00
R0739:Tm9sf4 UTSW 2 153203814 missense probably damaging 1.00
R1695:Tm9sf4 UTSW 2 153190912 missense probably benign 0.00
R3608:Tm9sf4 UTSW 2 153178977 missense probably benign
R4031:Tm9sf4 UTSW 2 153198344 splice site probably benign
R4668:Tm9sf4 UTSW 2 153187308 missense probably damaging 1.00
R4669:Tm9sf4 UTSW 2 153187308 missense probably damaging 1.00
R5318:Tm9sf4 UTSW 2 153187656 missense probably benign
R5580:Tm9sf4 UTSW 2 153182430 missense probably damaging 1.00
R5705:Tm9sf4 UTSW 2 153182458 missense probably benign 0.00
R5870:Tm9sf4 UTSW 2 153194281 missense probably damaging 1.00
R5996:Tm9sf4 UTSW 2 153195571 splice site probably null
R6115:Tm9sf4 UTSW 2 153182489 critical splice donor site probably null
R7448:Tm9sf4 UTSW 2 153194347 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- CATAGGAAGTCTATGCCCAAGC -3'
(R):5'- TATAATAGCTCTGGTCATCTCCAC -3'

Sequencing Primer
(F):5'- ATAAATCCAGATGTGGGGTTGTCATC -3'
(R):5'- TCCACTTTGGATGTAAAAGCAC -3'
Posted On2014-10-30