Incidental Mutation 'R2321:Reln'
ID 245635
Institutional Source Beutler Lab
Gene Symbol Reln
Ensembl Gene ENSMUSG00000042453
Gene Name reelin
Synonyms
MMRRC Submission 040313-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.951) question?
Stock # R2321 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 22089452-22549700 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 22120018 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 2878 (Y2878C)
Ref Sequence ENSEMBL: ENSMUSP00000124052 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062372] [ENSMUST00000161356]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000062372
AA Change: Y2878C

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000058025
Gene: ENSMUSG00000042453
AA Change: Y2878C

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Reeler 40 172 6.1e-24 PFAM
internal_repeat_3 195 360 5.04e-6 PROSPERO
EGF 674 702 1.2e1 SMART
EGF_like 1033 1061 6.95e1 SMART
EGF 1412 1442 6.02e0 SMART
EGF_like 1768 1796 2.92e1 SMART
low complexity region 1939 1948 N/A INTRINSIC
low complexity region 2062 2071 N/A INTRINSIC
EGF 2132 2161 1.43e-1 SMART
EGF_like 2481 2509 3.43e1 SMART
EGF 2856 2884 2.2e1 SMART
EGF 3231 3260 3.46e0 SMART
low complexity region 3450 3457 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000084713
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159768
Predicted Effect probably damaging
Transcript: ENSMUST00000161356
AA Change: Y2878C

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000124052
Gene: ENSMUSG00000042453
AA Change: Y2878C

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Reeler 54 171 2.9e-10 PFAM
internal_repeat_3 195 360 5.06e-6 PROSPERO
internal_repeat_2 207 413 3.41e-11 PROSPERO
EGF 674 702 1.2e1 SMART
EGF_like 1033 1061 6.95e1 SMART
EGF 1412 1442 6.02e0 SMART
internal_repeat_2 1452 1660 3.41e-11 PROSPERO
EGF_like 1768 1796 2.92e1 SMART
low complexity region 1939 1948 N/A INTRINSIC
low complexity region 2062 2071 N/A INTRINSIC
EGF 2132 2161 1.43e-1 SMART
EGF_like 2481 2509 3.43e1 SMART
EGF 2856 2884 2.2e1 SMART
EGF 3231 3260 3.46e0 SMART
low complexity region 3452 3459 N/A INTRINSIC
Meta Mutation Damage Score 0.6894 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large secreted extracellular matrix protein thought to control cell-cell interactions critical for cell positioning and neuronal migration during brain development. This protein may be involved in schizophrenia, autism, bipolar disorder, major depression and in migration defects associated with temporal lobe epilepsy. Mutations of this gene are associated with autosomal recessive lissencephaly with cerebellar hypoplasia. Two transcript variants encoding distinct isoforms have been identified for this gene. Other transcript variants have been described but their full length nature has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for most spontaneous or ENU-induced mutations show impaired righting responses, ataxia, tremors, and cerebellum and hippocampus abnormalities. Some mutants show postnatal or premature death and decreased body size while others have abnormal retinas or olfactory bulbs or infertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 C T 6: 128,557,349 (GRCm39) A115T probably benign Het
Abcf2 A T 5: 24,772,251 (GRCm39) Y492* probably null Het
Adcy9 A G 16: 4,106,132 (GRCm39) V994A probably damaging Het
Arhgef40 T C 14: 52,231,733 (GRCm39) probably benign Het
Bhlha15 T C 5: 144,128,014 (GRCm39) L42P probably damaging Het
Clca4b C A 3: 144,638,134 (GRCm39) A43S probably benign Het
Cpq A G 15: 33,594,291 (GRCm39) H434R probably benign Het
Crybg2 A G 4: 133,801,822 (GRCm39) E994G probably benign Het
Dcaf1 T C 9: 106,715,672 (GRCm39) L263S probably benign Het
Dnajc12 G T 10: 63,242,990 (GRCm39) probably benign Het
Fbxo32 T C 15: 58,054,689 (GRCm39) I215V possibly damaging Het
Krtap17-1 T C 11: 99,884,746 (GRCm39) D7G unknown Het
Men1 A G 19: 6,389,868 (GRCm39) D466G possibly damaging Het
Myh15 T A 16: 48,933,436 (GRCm39) F624I possibly damaging Het
Ncam1 A C 9: 49,456,132 (GRCm39) probably benign Het
Or2y1d A G 11: 49,322,107 (GRCm39) N268S probably benign Het
Otol1 T A 3: 69,925,858 (GRCm39) L11* probably null Het
Plekhg4 T C 8: 106,104,172 (GRCm39) S447P probably benign Het
Pnma8b G T 7: 16,679,490 (GRCm39) R158L unknown Het
Ppp1r2 A T 16: 31,084,121 (GRCm39) probably null Het
Rad51ap2 G A 12: 11,507,058 (GRCm39) G327R probably damaging Het
Rbm26 T C 14: 105,390,863 (GRCm39) T208A unknown Het
Rnps1 T A 17: 24,641,142 (GRCm39) F181I probably damaging Het
Senp6 A C 9: 80,031,022 (GRCm39) I575L possibly damaging Het
Serpinh1 T C 7: 98,995,592 (GRCm39) D330G probably damaging Het
Slamf9 G T 1: 172,304,980 (GRCm39) C198F probably damaging Het
Slc22a13 A T 9: 119,024,694 (GRCm39) V261D possibly damaging Het
Slc26a4 A G 12: 31,590,543 (GRCm39) V370A probably damaging Het
Tasp1 A G 2: 139,899,332 (GRCm39) M7T probably benign Het
Tet2 T C 3: 133,192,100 (GRCm39) N778S possibly damaging Het
Tm9sf4 T A 2: 153,046,506 (GRCm39) Y582N probably damaging Het
Tmem131l T A 3: 83,843,330 (GRCm39) H508L probably damaging Het
Tmem71 T G 15: 66,423,849 (GRCm39) D139A possibly damaging Het
Uroc1 A G 6: 90,324,229 (GRCm39) R418G possibly damaging Het
Wdr64 A C 1: 175,622,653 (GRCm39) K810T possibly damaging Het
Zgrf1 C A 3: 127,356,056 (GRCm39) Y427* probably null Het
Other mutations in Reln
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Reln APN 5 22,244,563 (GRCm39) missense possibly damaging 0.57
IGL00091:Reln APN 5 22,244,563 (GRCm39) missense possibly damaging 0.57
IGL00432:Reln APN 5 22,215,125 (GRCm39) missense probably damaging 1.00
IGL00433:Reln APN 5 22,250,007 (GRCm39) missense probably damaging 1.00
IGL00576:Reln APN 5 22,359,948 (GRCm39) missense probably benign 0.01
IGL00755:Reln APN 5 22,265,378 (GRCm39) missense probably damaging 0.98
IGL00777:Reln APN 5 22,223,848 (GRCm39) critical splice donor site probably null
IGL00900:Reln APN 5 22,185,115 (GRCm39) missense probably damaging 0.98
IGL01067:Reln APN 5 22,184,664 (GRCm39) missense probably damaging 1.00
IGL01104:Reln APN 5 22,191,965 (GRCm39) missense probably damaging 0.99
IGL01141:Reln APN 5 22,174,031 (GRCm39) missense probably damaging 1.00
IGL01141:Reln APN 5 22,124,067 (GRCm39) missense probably damaging 1.00
IGL01333:Reln APN 5 22,376,249 (GRCm39) missense probably damaging 0.99
IGL01341:Reln APN 5 22,174,077 (GRCm39) missense probably damaging 1.00
IGL01354:Reln APN 5 22,124,173 (GRCm39) nonsense probably null
IGL01361:Reln APN 5 22,124,019 (GRCm39) missense probably benign 0.06
IGL01446:Reln APN 5 22,174,315 (GRCm39) missense probably damaging 0.99
IGL01448:Reln APN 5 22,245,403 (GRCm39) missense probably benign 0.40
IGL01612:Reln APN 5 22,101,928 (GRCm39) missense probably damaging 0.99
IGL01695:Reln APN 5 22,125,436 (GRCm39) missense probably damaging 1.00
IGL01718:Reln APN 5 22,152,512 (GRCm39) missense possibly damaging 0.60
IGL01749:Reln APN 5 22,549,244 (GRCm39) nonsense probably null
IGL01875:Reln APN 5 22,109,715 (GRCm39) missense probably benign
IGL02013:Reln APN 5 22,155,877 (GRCm39) missense probably damaging 1.00
IGL02031:Reln APN 5 22,184,014 (GRCm39) missense probably damaging 0.99
IGL02186:Reln APN 5 22,114,956 (GRCm39) missense probably damaging 1.00
IGL02228:Reln APN 5 22,109,729 (GRCm39) missense probably damaging 0.99
IGL02248:Reln APN 5 22,115,990 (GRCm39) missense probably damaging 1.00
IGL02336:Reln APN 5 22,134,132 (GRCm39) missense probably damaging 1.00
IGL02352:Reln APN 5 22,244,563 (GRCm39) missense possibly damaging 0.57
IGL02359:Reln APN 5 22,244,563 (GRCm39) missense possibly damaging 0.57
IGL02376:Reln APN 5 22,285,789 (GRCm39) nonsense probably null
IGL02408:Reln APN 5 22,106,617 (GRCm39) missense probably benign 0.44
IGL02415:Reln APN 5 22,176,949 (GRCm39) missense possibly damaging 0.91
IGL02512:Reln APN 5 22,245,425 (GRCm39) missense probably benign 0.00
IGL02540:Reln APN 5 22,239,750 (GRCm39) missense probably damaging 0.96
IGL02624:Reln APN 5 22,308,355 (GRCm39) missense probably benign 0.09
IGL02720:Reln APN 5 22,202,939 (GRCm39) missense probably damaging 0.99
IGL02894:Reln APN 5 22,090,546 (GRCm39) missense possibly damaging 0.72
IGL02999:Reln APN 5 22,200,363 (GRCm39) missense probably damaging 1.00
IGL03125:Reln APN 5 22,115,842 (GRCm39) missense probably damaging 1.00
IGL03298:Reln APN 5 22,115,834 (GRCm39) missense probably damaging 0.99
Fishing UTSW 5 22,101,839 (GRCm39) missense probably damaging 1.00
P0020:Reln UTSW 5 22,311,058 (GRCm39) missense possibly damaging 0.91
PIT4151001:Reln UTSW 5 22,491,894 (GRCm39) missense possibly damaging 0.71
R0018:Reln UTSW 5 22,130,369 (GRCm39) missense probably benign 0.01
R0105:Reln UTSW 5 22,253,813 (GRCm39) missense probably damaging 0.99
R0105:Reln UTSW 5 22,253,813 (GRCm39) missense probably damaging 0.99
R0127:Reln UTSW 5 22,209,134 (GRCm39) missense probably damaging 1.00
R0135:Reln UTSW 5 22,333,647 (GRCm39) missense probably damaging 0.99
R0144:Reln UTSW 5 22,153,447 (GRCm39) missense probably damaging 0.97
R0240:Reln UTSW 5 22,311,043 (GRCm39) missense probably benign 0.36
R0240:Reln UTSW 5 22,311,043 (GRCm39) missense probably benign 0.36
R0242:Reln UTSW 5 22,147,595 (GRCm39) critical splice donor site probably null
R0242:Reln UTSW 5 22,147,595 (GRCm39) critical splice donor site probably null
R0266:Reln UTSW 5 22,193,774 (GRCm39) missense probably damaging 1.00
R0269:Reln UTSW 5 22,125,535 (GRCm39) missense probably damaging 1.00
R0280:Reln UTSW 5 22,432,511 (GRCm39) splice site probably benign
R0333:Reln UTSW 5 22,134,240 (GRCm39) missense probably damaging 0.97
R0357:Reln UTSW 5 22,155,820 (GRCm39) missense probably damaging 1.00
R0359:Reln UTSW 5 22,253,798 (GRCm39) missense probably damaging 0.98
R0506:Reln UTSW 5 22,125,494 (GRCm39) missense probably damaging 0.97
R0534:Reln UTSW 5 22,152,406 (GRCm39) missense probably damaging 0.99
R0535:Reln UTSW 5 22,256,274 (GRCm39) splice site probably benign
R0541:Reln UTSW 5 22,185,107 (GRCm39) missense possibly damaging 0.88
R0615:Reln UTSW 5 22,215,148 (GRCm39) missense probably benign 0.36
R0617:Reln UTSW 5 22,125,535 (GRCm39) missense probably damaging 1.00
R0634:Reln UTSW 5 22,223,867 (GRCm39) missense probably damaging 1.00
R0653:Reln UTSW 5 22,118,228 (GRCm39) missense probably benign 0.44
R0704:Reln UTSW 5 22,101,809 (GRCm39) missense probably damaging 0.99
R0706:Reln UTSW 5 22,101,809 (GRCm39) missense probably damaging 0.99
R0959:Reln UTSW 5 22,432,626 (GRCm39) missense probably damaging 0.96
R1066:Reln UTSW 5 22,239,662 (GRCm39) missense probably damaging 1.00
R1110:Reln UTSW 5 22,239,773 (GRCm39) missense probably benign
R1163:Reln UTSW 5 22,104,027 (GRCm39) missense probably benign 0.03
R1222:Reln UTSW 5 22,191,953 (GRCm39) missense probably null 0.97
R1226:Reln UTSW 5 22,115,864 (GRCm39) missense probably damaging 1.00
R1440:Reln UTSW 5 22,333,600 (GRCm39) splice site probably benign
R1532:Reln UTSW 5 22,239,742 (GRCm39) missense probably damaging 0.99
R1552:Reln UTSW 5 22,165,376 (GRCm39) missense probably benign 0.01
R1565:Reln UTSW 5 22,130,211 (GRCm39) missense probably benign 0.05
R1618:Reln UTSW 5 22,265,366 (GRCm39) missense probably benign 0.01
R1636:Reln UTSW 5 22,203,681 (GRCm39) missense probably damaging 0.99
R1664:Reln UTSW 5 22,134,084 (GRCm39) missense probably damaging 1.00
R1716:Reln UTSW 5 22,160,093 (GRCm39) missense probably damaging 0.98
R1759:Reln UTSW 5 22,215,287 (GRCm39) missense probably damaging 0.99
R1835:Reln UTSW 5 22,184,000 (GRCm39) missense probably damaging 1.00
R1907:Reln UTSW 5 22,249,960 (GRCm39) critical splice donor site probably null
R1991:Reln UTSW 5 22,174,358 (GRCm39) missense possibly damaging 0.56
R2046:Reln UTSW 5 22,147,625 (GRCm39) missense probably benign 0.01
R2072:Reln UTSW 5 22,124,175 (GRCm39) missense probably damaging 1.00
R2103:Reln UTSW 5 22,174,358 (GRCm39) missense possibly damaging 0.56
R2119:Reln UTSW 5 22,223,998 (GRCm39) missense probably damaging 1.00
R2120:Reln UTSW 5 22,174,083 (GRCm39) missense probably damaging 1.00
R2216:Reln UTSW 5 22,253,003 (GRCm39) missense probably benign 0.30
R2219:Reln UTSW 5 22,177,045 (GRCm39) missense possibly damaging 0.88
R2228:Reln UTSW 5 22,192,076 (GRCm39) missense possibly damaging 0.69
R2306:Reln UTSW 5 22,101,784 (GRCm39) missense probably damaging 1.00
R2316:Reln UTSW 5 22,359,954 (GRCm39) missense probably benign 0.00
R2512:Reln UTSW 5 22,184,688 (GRCm39) missense possibly damaging 0.89
R2519:Reln UTSW 5 22,549,367 (GRCm39) missense unknown
R2870:Reln UTSW 5 22,254,789 (GRCm39) missense possibly damaging 0.95
R2870:Reln UTSW 5 22,254,789 (GRCm39) missense possibly damaging 0.95
R2871:Reln UTSW 5 22,254,789 (GRCm39) missense possibly damaging 0.95
R2871:Reln UTSW 5 22,254,789 (GRCm39) missense possibly damaging 0.95
R2872:Reln UTSW 5 22,254,789 (GRCm39) missense possibly damaging 0.95
R2872:Reln UTSW 5 22,254,789 (GRCm39) missense possibly damaging 0.95
R3195:Reln UTSW 5 22,245,418 (GRCm39) missense possibly damaging 0.72
R3545:Reln UTSW 5 22,432,598 (GRCm39) missense possibly damaging 0.64
R3546:Reln UTSW 5 22,432,598 (GRCm39) missense possibly damaging 0.64
R3547:Reln UTSW 5 22,432,598 (GRCm39) missense possibly damaging 0.64
R3706:Reln UTSW 5 22,200,587 (GRCm39) splice site probably benign
R3713:Reln UTSW 5 22,109,732 (GRCm39) missense probably damaging 0.99
R3770:Reln UTSW 5 22,153,564 (GRCm39) missense probably damaging 1.00
R3836:Reln UTSW 5 22,116,012 (GRCm39) missense probably damaging 1.00
R3887:Reln UTSW 5 22,115,847 (GRCm39) missense possibly damaging 0.92
R3972:Reln UTSW 5 22,183,999 (GRCm39) missense probably damaging 0.99
R3975:Reln UTSW 5 22,200,364 (GRCm39) missense possibly damaging 0.57
R4022:Reln UTSW 5 22,432,628 (GRCm39) missense probably benign 0.45
R4044:Reln UTSW 5 22,333,630 (GRCm39) missense possibly damaging 0.82
R4107:Reln UTSW 5 22,239,582 (GRCm39) missense probably damaging 1.00
R4297:Reln UTSW 5 22,125,485 (GRCm39) missense probably damaging 0.99
R4298:Reln UTSW 5 22,125,485 (GRCm39) missense probably damaging 0.99
R4299:Reln UTSW 5 22,125,485 (GRCm39) missense probably damaging 0.99
R4518:Reln UTSW 5 22,106,741 (GRCm39) missense probably benign 0.44
R4615:Reln UTSW 5 22,177,870 (GRCm39) missense possibly damaging 0.95
R4713:Reln UTSW 5 22,357,461 (GRCm39) missense probably benign 0.17
R4720:Reln UTSW 5 22,491,894 (GRCm39) missense possibly damaging 0.71
R4721:Reln UTSW 5 22,124,220 (GRCm39) missense probably damaging 0.99
R4771:Reln UTSW 5 22,254,698 (GRCm39) missense probably damaging 1.00
R4794:Reln UTSW 5 22,549,183 (GRCm39) missense probably damaging 0.98
R4840:Reln UTSW 5 22,223,844 (GRCm39) splice site probably null
R4860:Reln UTSW 5 22,106,749 (GRCm39) missense probably benign 0.06
R4860:Reln UTSW 5 22,106,749 (GRCm39) missense probably benign 0.06
R4896:Reln UTSW 5 22,160,236 (GRCm39) missense probably damaging 1.00
R4908:Reln UTSW 5 22,184,718 (GRCm39) missense probably benign 0.02
R4912:Reln UTSW 5 22,130,191 (GRCm39) missense probably benign 0.29
R4922:Reln UTSW 5 22,200,585 (GRCm39) critical splice acceptor site probably null
R4975:Reln UTSW 5 22,165,424 (GRCm39) missense probably damaging 1.00
R4976:Reln UTSW 5 22,176,868 (GRCm39) missense probably benign 0.05
R5020:Reln UTSW 5 22,239,636 (GRCm39) missense probably damaging 1.00
R5037:Reln UTSW 5 22,153,510 (GRCm39) missense probably damaging 1.00
R5082:Reln UTSW 5 22,101,075 (GRCm39) missense probably benign 0.00
R5119:Reln UTSW 5 22,176,868 (GRCm39) missense probably benign 0.05
R5125:Reln UTSW 5 22,118,239 (GRCm39) missense possibly damaging 0.78
R5137:Reln UTSW 5 22,160,179 (GRCm39) missense probably damaging 1.00
R5152:Reln UTSW 5 22,153,627 (GRCm39) missense probably damaging 1.00
R5154:Reln UTSW 5 22,193,763 (GRCm39) missense probably damaging 0.99
R5259:Reln UTSW 5 22,308,395 (GRCm39) missense possibly damaging 0.83
R5283:Reln UTSW 5 22,216,161 (GRCm39) missense probably damaging 1.00
R5386:Reln UTSW 5 22,244,527 (GRCm39) missense probably benign
R5400:Reln UTSW 5 22,184,712 (GRCm39) missense probably damaging 1.00
R5478:Reln UTSW 5 22,209,201 (GRCm39) missense probably benign 0.00
R5514:Reln UTSW 5 22,176,883 (GRCm39) missense possibly damaging 0.93
R5529:Reln UTSW 5 22,137,713 (GRCm39) missense possibly damaging 0.71
R5611:Reln UTSW 5 22,244,663 (GRCm39) nonsense probably null
R5648:Reln UTSW 5 22,203,570 (GRCm39) missense probably benign 0.04
R5649:Reln UTSW 5 22,106,623 (GRCm39) missense probably benign 0.33
R5744:Reln UTSW 5 22,311,081 (GRCm39) missense probably null 0.39
R5782:Reln UTSW 5 22,223,054 (GRCm39) missense probably benign 0.01
R5815:Reln UTSW 5 22,152,431 (GRCm39) missense probably damaging 0.99
R5838:Reln UTSW 5 22,104,111 (GRCm39) missense probably damaging 0.97
R6162:Reln UTSW 5 22,116,048 (GRCm39) missense probably damaging 1.00
R6219:Reln UTSW 5 22,153,594 (GRCm39) missense probably damaging 1.00
R6259:Reln UTSW 5 22,265,331 (GRCm39) missense probably damaging 0.99
R6279:Reln UTSW 5 22,101,839 (GRCm39) missense probably damaging 1.00
R6299:Reln UTSW 5 22,491,942 (GRCm39) missense possibly damaging 0.71
R6300:Reln UTSW 5 22,101,839 (GRCm39) missense probably damaging 1.00
R6314:Reln UTSW 5 22,357,482 (GRCm39) nonsense probably null
R6351:Reln UTSW 5 22,106,661 (GRCm39) nonsense probably null
R6369:Reln UTSW 5 22,256,359 (GRCm39) missense probably benign 0.03
R6371:Reln UTSW 5 22,200,511 (GRCm39) missense probably benign
R6374:Reln UTSW 5 22,285,712 (GRCm39) missense probably benign 0.06
R6425:Reln UTSW 5 22,116,018 (GRCm39) nonsense probably null
R6442:Reln UTSW 5 22,137,774 (GRCm39) missense probably benign
R6445:Reln UTSW 5 22,124,212 (GRCm39) missense probably benign 0.05
R6554:Reln UTSW 5 22,101,838 (GRCm39) missense probably damaging 1.00
R6641:Reln UTSW 5 22,134,132 (GRCm39) missense probably damaging 1.00
R6768:Reln UTSW 5 22,183,905 (GRCm39) missense probably damaging 0.99
R6859:Reln UTSW 5 22,239,568 (GRCm39) missense probably damaging 1.00
R6896:Reln UTSW 5 22,104,177 (GRCm39) missense probably benign 0.18
R6932:Reln UTSW 5 22,190,855 (GRCm39) missense probably benign 0.00
R6948:Reln UTSW 5 22,177,033 (GRCm39) missense probably damaging 1.00
R6959:Reln UTSW 5 22,181,562 (GRCm39) missense probably damaging 1.00
R7085:Reln UTSW 5 22,120,085 (GRCm39) nonsense probably null
R7091:Reln UTSW 5 22,104,027 (GRCm39) missense probably null 0.08
R7135:Reln UTSW 5 22,181,594 (GRCm39) missense possibly damaging 0.95
R7146:Reln UTSW 5 22,311,095 (GRCm39) missense probably damaging 0.97
R7167:Reln UTSW 5 22,147,618 (GRCm39) missense probably damaging 1.00
R7190:Reln UTSW 5 22,252,945 (GRCm39) missense probably damaging 1.00
R7256:Reln UTSW 5 22,183,921 (GRCm39) missense probably benign 0.03
R7393:Reln UTSW 5 22,181,349 (GRCm39) missense probably damaging 0.99
R7399:Reln UTSW 5 22,256,365 (GRCm39) missense probably damaging 0.99
R7400:Reln UTSW 5 22,176,932 (GRCm39) missense probably damaging 0.99
R7426:Reln UTSW 5 22,176,951 (GRCm39) missense probably damaging 1.00
R7463:Reln UTSW 5 22,308,433 (GRCm39) missense probably damaging 0.98
R7470:Reln UTSW 5 22,147,739 (GRCm39) missense probably damaging 0.99
R7473:Reln UTSW 5 22,134,125 (GRCm39) missense probably benign 0.25
R7501:Reln UTSW 5 22,432,636 (GRCm39) missense possibly damaging 0.91
R7542:Reln UTSW 5 22,160,179 (GRCm39) missense probably damaging 1.00
R7544:Reln UTSW 5 22,181,276 (GRCm39) nonsense probably null
R7588:Reln UTSW 5 22,090,566 (GRCm39) missense probably benign 0.03
R7631:Reln UTSW 5 22,176,933 (GRCm39) missense probably damaging 0.97
R7644:Reln UTSW 5 22,183,929 (GRCm39) missense probably benign 0.39
R7834:Reln UTSW 5 22,244,633 (GRCm39) missense possibly damaging 0.94
R7923:Reln UTSW 5 22,339,690 (GRCm39) missense probably benign 0.00
R7938:Reln UTSW 5 22,155,870 (GRCm39) missense probably damaging 0.97
R8006:Reln UTSW 5 22,104,082 (GRCm39) nonsense probably null
R8062:Reln UTSW 5 22,176,990 (GRCm39) missense probably benign 0.00
R8222:Reln UTSW 5 22,136,475 (GRCm39) nonsense probably null
R8266:Reln UTSW 5 22,223,085 (GRCm39) missense possibly damaging 0.62
R8267:Reln UTSW 5 22,209,110 (GRCm39) missense probably damaging 1.00
R8487:Reln UTSW 5 22,104,027 (GRCm39) missense probably benign 0.03
R8523:Reln UTSW 5 22,209,229 (GRCm39) missense probably damaging 1.00
R8751:Reln UTSW 5 22,147,672 (GRCm39) missense probably benign 0.37
R8801:Reln UTSW 5 22,155,854 (GRCm39) missense possibly damaging 0.94
R8802:Reln UTSW 5 22,130,257 (GRCm39) missense probably damaging 0.98
R8978:Reln UTSW 5 22,090,512 (GRCm39) missense possibly damaging 0.85
R8988:Reln UTSW 5 22,104,155 (GRCm39) missense probably damaging 0.97
R8995:Reln UTSW 5 22,184,577 (GRCm39) missense probably benign 0.00
R9022:Reln UTSW 5 22,181,613 (GRCm39) missense possibly damaging 0.66
R9042:Reln UTSW 5 22,253,036 (GRCm39) missense probably damaging 1.00
R9069:Reln UTSW 5 22,216,059 (GRCm39) missense probably damaging 1.00
R9089:Reln UTSW 5 22,130,198 (GRCm39) missense probably benign 0.01
R9126:Reln UTSW 5 22,160,194 (GRCm39) missense probably damaging 1.00
R9172:Reln UTSW 5 22,155,815 (GRCm39) critical splice donor site probably null
R9182:Reln UTSW 5 22,106,617 (GRCm39) missense probably benign 0.44
R9196:Reln UTSW 5 22,357,471 (GRCm39) missense probably damaging 1.00
R9211:Reln UTSW 5 22,549,200 (GRCm39) nonsense probably null
R9241:Reln UTSW 5 22,174,067 (GRCm39) missense probably damaging 0.99
R9244:Reln UTSW 5 22,120,151 (GRCm39) missense probably damaging 0.99
R9281:Reln UTSW 5 22,153,545 (GRCm39) missense probably damaging 1.00
R9295:Reln UTSW 5 22,209,209 (GRCm39) missense possibly damaging 0.95
R9303:Reln UTSW 5 22,193,705 (GRCm39) missense possibly damaging 0.95
R9303:Reln UTSW 5 22,285,689 (GRCm39) missense probably benign 0.01
R9309:Reln UTSW 5 22,176,866 (GRCm39) missense probably benign 0.37
R9338:Reln UTSW 5 22,202,937 (GRCm39) missense probably damaging 0.98
R9381:Reln UTSW 5 22,549,202 (GRCm39) missense possibly damaging 0.93
R9430:Reln UTSW 5 22,120,105 (GRCm39) missense probably damaging 1.00
R9509:Reln UTSW 5 22,549,198 (GRCm39) missense possibly damaging 0.93
R9515:Reln UTSW 5 22,125,508 (GRCm39) missense possibly damaging 0.46
R9717:Reln UTSW 5 22,136,427 (GRCm39) missense probably benign 0.26
R9745:Reln UTSW 5 22,152,525 (GRCm39) missense probably damaging 1.00
R9778:Reln UTSW 5 22,155,943 (GRCm39) missense probably damaging 1.00
Z1176:Reln UTSW 5 22,184,022 (GRCm39) missense probably damaging 1.00
Z1177:Reln UTSW 5 22,209,080 (GRCm39) missense probably damaging 0.96
Z1177:Reln UTSW 5 22,174,239 (GRCm39) missense probably damaging 0.96
Z1177:Reln UTSW 5 22,432,634 (GRCm39) missense probably damaging 1.00
Z1177:Reln UTSW 5 22,359,957 (GRCm39) missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- GAGGGCTATCCATAATATTTGCTTC -3'
(R):5'- AGTTGCAAGTGGTCAGATACG -3'

Sequencing Primer
(F):5'- TGGACATAGTGGCACATACCTTC -3'
(R):5'- GTTCATCCACAGAGATAACTGCAGTG -3'
Posted On 2014-10-30