Incidental Mutation 'R2321:Olfr1389'
ID245648
Institutional Source Beutler Lab
Gene Symbol Olfr1389
Ensembl Gene ENSMUSG00000107573
Gene Nameolfactory receptor 1389
SynonymsGA_x6K02T2QP88-6004387-6003452, MOR256-1
MMRRC Submission 040313-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.205) question?
Stock #R2321 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location49423067-49432968 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 49431280 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 268 (N268S)
Ref Sequence ENSEMBL: ENSMUSP00000149222 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000203369] [ENSMUST00000216641] [ENSMUST00000217595]
Predicted Effect probably benign
Transcript: ENSMUST00000052274
AA Change: N268S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000052151
Gene: ENSMUSG00000046575
AA Change: N268S

DomainStartEndE-ValueType
Pfam:7tm_4 30 306 1.9e-49 PFAM
Pfam:7tm_1 41 289 6.6e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000203369
AA Change: N268S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000145461
Gene: ENSMUSG00000107573
AA Change: N268S

DomainStartEndE-ValueType
Pfam:7tm_4 30 306 1.9e-49 PFAM
Pfam:7tm_1 41 289 6.6e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000216641
AA Change: N268S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000217595
AA Change: N268S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Meta Mutation Damage Score 0.1224 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 C T 6: 128,580,386 A115T probably benign Het
Abcf2 A T 5: 24,567,253 Y492* probably null Het
Adcy9 A G 16: 4,288,268 V994A probably damaging Het
Arhgef40 T C 14: 51,994,276 probably benign Het
Bhlha15 T C 5: 144,191,196 L42P probably damaging Het
Clca4b C A 3: 144,932,373 A43S probably benign Het
Cpq A G 15: 33,594,145 H434R probably benign Het
Crybg2 A G 4: 134,074,511 E994G probably benign Het
Dcaf1 T C 9: 106,838,473 L263S probably benign Het
Dnajc12 G T 10: 63,407,211 probably benign Het
Fbxo32 T C 15: 58,191,293 I215V possibly damaging Het
Krtap17-1 T C 11: 99,993,920 D7G unknown Het
Men1 A G 19: 6,339,838 D466G possibly damaging Het
Myh15 T A 16: 49,113,073 F624I possibly damaging Het
Ncam1 A C 9: 49,544,832 probably benign Het
Otol1 T A 3: 70,018,525 L11* probably null Het
Plekhg4 T C 8: 105,377,540 S447P probably benign Het
Pnmal2 G T 7: 16,945,565 R158L unknown Het
Ppp1r2 A T 16: 31,265,303 probably null Het
Rad51ap2 G A 12: 11,457,057 G327R probably damaging Het
Rbm26 T C 14: 105,153,427 T208A unknown Het
Reln T C 5: 21,915,020 Y2878C probably damaging Het
Rnps1 T A 17: 24,422,168 F181I probably damaging Het
Senp6 A C 9: 80,123,740 I575L possibly damaging Het
Serpinh1 T C 7: 99,346,385 D330G probably damaging Het
Slamf9 G T 1: 172,477,413 C198F probably damaging Het
Slc22a13 A T 9: 119,195,628 V261D possibly damaging Het
Slc26a4 A G 12: 31,540,544 V370A probably damaging Het
Tasp1 A G 2: 140,057,412 M7T probably benign Het
Tet2 T C 3: 133,486,339 N778S possibly damaging Het
Tm9sf4 T A 2: 153,204,586 Y582N probably damaging Het
Tmem131l T A 3: 83,936,023 H508L probably damaging Het
Tmem71 T G 15: 66,552,000 D139A possibly damaging Het
Uroc1 A G 6: 90,347,247 R418G possibly damaging Het
Wdr64 A C 1: 175,795,087 K810T possibly damaging Het
Zgrf1 C A 3: 127,562,407 Y427* probably null Het
Other mutations in Olfr1389
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02377:Olfr1389 APN 11 49431032 missense probably damaging 1.00
IGL02468:Olfr1389 APN 11 49431114 missense probably damaging 0.99
IGL02607:Olfr1389 APN 11 49430512 missense probably damaging 1.00
IGL02721:Olfr1389 APN 11 49430641 nonsense probably null
IGL02812:Olfr1389 APN 11 49430922 missense probably damaging 1.00
IGL03086:Olfr1389 APN 11 49430805 missense probably benign 0.03
IGL03047:Olfr1389 UTSW 11 49430967 missense probably benign 0.10
PIT4531001:Olfr1389 UTSW 11 49430926 missense probably benign 0.01
R0413:Olfr1389 UTSW 11 49431385 missense possibly damaging 0.82
R0598:Olfr1389 UTSW 11 49431403 missense probably benign 0.00
R0653:Olfr1389 UTSW 11 49431251 nonsense probably null
R1654:Olfr1389 UTSW 11 49430502 missense probably benign 0.00
R4995:Olfr1389 UTSW 11 49430655 missense probably damaging 1.00
R5670:Olfr1389 UTSW 11 49431208 missense probably damaging 1.00
R6127:Olfr1389 UTSW 11 49430806 missense probably damaging 0.97
R6327:Olfr1389 UTSW 11 49431001 missense probably damaging 1.00
R6935:Olfr1389 UTSW 11 49430998 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CACTGATTCTGGGCTCCTATGG -3'
(R):5'- AATGGTTCTGGGACCCTGAG -3'

Sequencing Primer
(F):5'- TCCTATGGACACATTGCCAGAG -3'
(R):5'- GTCACTAGTGTCCCTCAAAGGTG -3'
Posted On2014-10-30