Incidental Mutation 'R2327:Gpld1'
ID245722
Institutional Source Beutler Lab
Gene Symbol Gpld1
Ensembl Gene ENSMUSG00000021340
Gene Nameglycosylphosphatidylinositol specific phospholipase D1
Synonyms6330541J12Rik
MMRRC Submission 040318-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2327 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location24943152-24992501 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 24984821 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 773 (M773L)
Ref Sequence ENSEMBL: ENSMUSP00000021773 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021772] [ENSMUST00000021773]
Predicted Effect probably benign
Transcript: ENSMUST00000021772
SMART Domains Protein: ENSMUSP00000021772
Gene: ENSMUSG00000021339

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
low complexity region 292 306 N/A INTRINSIC
coiled coil region 323 359 N/A INTRINSIC
transmembrane domain 374 396 N/A INTRINSIC
transmembrane domain 409 426 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000021773
AA Change: M773L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000021773
Gene: ENSMUSG00000021340
AA Change: M773L

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Zn_dep_PLPC 28 219 9.8e-28 PFAM
Int_alpha 377 435 7.21e-11 SMART
Int_alpha 446 503 7.43e-13 SMART
Int_alpha 509 565 7.86e-3 SMART
Int_alpha 576 643 4.09e0 SMART
Blast:Int_alpha 644 708 2e-24 BLAST
Int_alpha 716 774 1.86e-4 SMART
Blast:Int_alpha 789 837 1e-16 BLAST
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Many proteins are tethered to the extracellular face of eukaryotic plasma membranes by a glycosylphosphatidylinositol (GPI) anchor. The GPI-anchor is a glycolipid found on many blood cells. The protein encoded by this gene is a GPI degrading enzyme. Glycosylphosphatidylinositol specific phospholipase D1 hydrolyzes the inositol phosphate linkage in proteins anchored by phosphatidylinositol glycans, thereby releasing the attached protein from the plasma membrane. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578I06Rik A T 14: 63,971,120 probably null Het
Agbl4 T G 4: 111,526,601 S218A probably benign Het
Apol11b T C 15: 77,637,953 E48G probably damaging Het
Atp4a T A 7: 30,720,241 N676K probably benign Het
Capn5 T A 7: 98,126,367 S456C probably benign Het
Ccar1 T C 10: 62,764,382 Y590C probably damaging Het
Ccdc188 G T 16: 18,219,206 G283W probably damaging Het
Cd163l1 A T 7: 140,223,977 N363Y possibly damaging Het
Cd69 A G 6: 129,271,388 V45A probably damaging Het
Col3a1 G T 1: 45,338,611 probably benign Het
Cyb561a3 A T 19: 10,586,802 T169S probably benign Het
Cyp2c39 A T 19: 39,538,953 I248L probably benign Het
Cyp2j13 T C 4: 96,059,107 T236A possibly damaging Het
Efs A G 14: 54,917,504 V426A probably benign Het
Eme2 A G 17: 24,894,183 L136S probably damaging Het
Fastkd1 T A 2: 69,705,528 K312* probably null Het
Fbxl12 A G 9: 20,642,234 L19P probably damaging Het
Flg2 T A 3: 93,203,606 Y980* probably null Het
Fscn2 T A 11: 120,366,701 I296N probably damaging Het
Gabrg3 A G 7: 56,735,087 V242A probably benign Het
Galk2 A G 2: 125,975,395 H368R probably damaging Het
Gm10184 C A 17: 89,910,269 R16S probably benign Het
Gm12695 C T 4: 96,769,656 S92N probably benign Het
Gpalpp1 A T 14: 76,098,591 S196T probably benign Het
Haus8 A G 8: 71,255,645 probably null Het
Hirip3 A G 7: 126,862,866 R19G probably damaging Het
Inpp4a A G 1: 37,366,166 T92A probably damaging Het
Irgm2 A G 11: 58,220,392 D303G probably damaging Het
Krtap5-2 T G 7: 142,175,011 S311R unknown Het
Krtdap T A 7: 30,789,760 probably null Het
Lce1g G T 3: 92,750,833 S56Y unknown Het
Lrrn1 G A 6: 107,568,833 V531I probably benign Het
Mctp2 T C 7: 72,211,610 E429G probably damaging Het
Mrgpra2b T G 7: 47,464,045 D287A probably damaging Het
Mterf3 T C 13: 66,928,194 T150A probably damaging Het
Mtus2 A G 5: 148,077,915 N506S probably benign Het
Myh15 G T 16: 49,142,950 V1085L probably benign Het
Myo9a A G 9: 59,779,765 N51S probably benign Het
Nlrc3 A T 16: 3,953,440 L196Q probably damaging Het
Nlrp9c T A 7: 26,375,322 N816I probably damaging Het
Nsun2 T C 13: 69,619,581 V218A probably benign Het
Nt5dc1 T C 10: 34,313,677 E339G possibly damaging Het
Olfr1062 A T 2: 86,422,821 L285* probably null Het
Olfr1338 C T 4: 118,754,134 V135I probably benign Het
Olfr623 A G 7: 103,660,572 V226A probably damaging Het
Pik3ap1 A G 19: 41,296,389 I619T probably damaging Het
Plk1 A G 7: 122,159,895 D118G probably benign Het
Ppat T C 5: 76,922,467 D168G possibly damaging Het
Preb T C 5: 30,958,505 E198G probably damaging Het
Psg21 T C 7: 18,652,453 T203A possibly damaging Het
Rbm17 A G 2: 11,598,131 V54A probably damaging Het
Rgma T A 7: 73,417,826 D276E probably damaging Het
Ric8a T C 7: 140,859,558 L77P probably damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Scarf1 A C 11: 75,526,028 E765D probably damaging Het
Sec14l4 G A 11: 4,040,041 M113I probably benign Het
Senp1 C T 15: 98,082,284 C60Y probably damaging Het
Slc22a21 T A 11: 53,951,304 K549N probably benign Het
Slc39a10 T C 1: 46,835,996 S49G probably damaging Het
Spata13 T C 14: 60,709,555 M684T probably damaging Het
Spns1 T C 7: 126,370,786 T481A probably damaging Het
Stag1 A G 9: 100,786,613 Y198C possibly damaging Het
Tgfbr1 T A 4: 47,402,833 V210E probably damaging Het
Tnc C T 4: 63,975,238 E1604K possibly damaging Het
Tspan31 T C 10: 127,068,496 D143G probably benign Het
Tspan5 T A 3: 138,898,142 Y131* probably null Het
Ttc21a A G 9: 119,966,123 D1070G probably damaging Het
Vmn2r26 C T 6: 124,039,749 P391S probably benign Het
Vmn2r72 A G 7: 85,738,256 I700T probably damaging Het
Vps13c A C 9: 67,913,820 N1204T probably damaging Het
Zfhx4 C T 3: 5,403,358 P2859S probably benign Het
Other mutations in Gpld1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:Gpld1 APN 13 24986922 splice site probably benign
IGL00886:Gpld1 APN 13 24962353 nonsense probably null
IGL01060:Gpld1 APN 13 24982566 missense probably damaging 1.00
IGL01450:Gpld1 APN 13 24979681 missense probably damaging 1.00
IGL02176:Gpld1 APN 13 24984209 critical splice donor site probably null
IGL02288:Gpld1 APN 13 24979683 nonsense probably null
IGL02323:Gpld1 APN 13 24982774 missense probably damaging 0.97
IGL02588:Gpld1 APN 13 24943699 missense probably damaging 1.00
IGL02832:Gpld1 APN 13 24952878 missense probably damaging 1.00
IGL02989:Gpld1 APN 13 24990036 missense possibly damaging 0.87
IGL03282:Gpld1 APN 13 24971408 missense probably benign 0.01
IGL03345:Gpld1 APN 13 24987024 missense probably damaging 1.00
R0017:Gpld1 UTSW 13 24990118 missense probably damaging 1.00
R0017:Gpld1 UTSW 13 24990118 missense probably damaging 1.00
R0308:Gpld1 UTSW 13 24962835 missense possibly damaging 0.81
R0441:Gpld1 UTSW 13 24962320 nonsense probably null
R1172:Gpld1 UTSW 13 24957566 splice site probably null
R1411:Gpld1 UTSW 13 24962808 missense probably damaging 0.99
R1502:Gpld1 UTSW 13 24971416 missense probably benign 0.00
R1565:Gpld1 UTSW 13 24956068 missense probably damaging 0.99
R1931:Gpld1 UTSW 13 24943710 missense possibly damaging 0.71
R1999:Gpld1 UTSW 13 24962647 missense probably benign 0.23
R2150:Gpld1 UTSW 13 24962647 missense probably benign 0.23
R2240:Gpld1 UTSW 13 24982507 critical splice acceptor site probably null
R2373:Gpld1 UTSW 13 24962856 missense probably benign 0.26
R3153:Gpld1 UTSW 13 24943620 missense unknown
R3154:Gpld1 UTSW 13 24943620 missense unknown
R3154:Gpld1 UTSW 13 24956163 critical splice donor site probably null
R3911:Gpld1 UTSW 13 24962322 missense probably damaging 1.00
R4616:Gpld1 UTSW 13 24984816 missense probably damaging 1.00
R4660:Gpld1 UTSW 13 24982603 unclassified probably null
R4755:Gpld1 UTSW 13 24979688 missense probably benign 0.13
R4755:Gpld1 UTSW 13 24979692 nonsense probably null
R4835:Gpld1 UTSW 13 24982716 missense probably benign 0.00
R4895:Gpld1 UTSW 13 24979728 missense probably damaging 0.97
R5050:Gpld1 UTSW 13 24962756 missense probably benign 0.00
R5182:Gpld1 UTSW 13 24984070 unclassified probably null
R6161:Gpld1 UTSW 13 24971414 missense probably benign 0.00
R6626:Gpld1 UTSW 13 24979970 missense probably damaging 1.00
R7021:Gpld1 UTSW 13 24984708 missense probably damaging 1.00
X0024:Gpld1 UTSW 13 24982596 missense probably benign
Predicted Primers PCR Primer
(F):5'- AAGGCCTTTCACTGACTTTGG -3'
(R):5'- GCTGTGAACAAGGACCAAGTC -3'

Sequencing Primer
(F):5'- AGCCGTGGCAACTGGTTAC -3'
(R):5'- CCAAGTCCAACTGGGTTCC -3'
Posted On2014-10-30