Incidental Mutation 'R2328:Plekhm3'
ID245741
Institutional Source Beutler Lab
Gene Symbol Plekhm3
Ensembl Gene ENSMUSG00000051344
Gene Namepleckstrin homology domain containing, family M, member 3
Synonyms9430067K14Rik, A230102O09Rik, Plekhm1l
MMRRC Submission 040319-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.120) question?
Stock #R2328 (G1)
Quality Score116
Status Not validated
Chromosome1
Chromosomal Location64785983-64956824 bp(-) (GRCm38)
Type of Mutationsmall deletion (1 aa in frame mutation)
DNA Base Change (assembly) CCTGCTGCTGCTGCTGCTGCTGCTGC to CCTGCTGCTGCTGCTGCTGCTGC at 64937781 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000138002 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097713] [ENSMUST00000123225] [ENSMUST00000139649]
Predicted Effect probably benign
Transcript: ENSMUST00000097713
SMART Domains Protein: ENSMUSP00000095320
Gene: ENSMUSG00000051344

DomainStartEndE-ValueType
low complexity region 184 195 N/A INTRINSIC
PH 213 311 4.86e-3 SMART
PH 362 458 7.88e-12 SMART
low complexity region 489 503 N/A INTRINSIC
DUF4206 529 732 2.73e-114 SMART
C1 670 722 3.9e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123225
Predicted Effect probably benign
Transcript: ENSMUST00000139649
SMART Domains Protein: ENSMUSP00000138002
Gene: ENSMUSG00000051344

DomainStartEndE-ValueType
low complexity region 184 195 N/A INTRINSIC
PH 213 311 4.86e-3 SMART
PH 362 458 7.88e-12 SMART
low complexity region 489 503 N/A INTRINSIC
DUF4206 529 732 2.73e-114 SMART
C1 670 722 3.9e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181350
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl3 T A 4: 144,455,932 Y322F probably benign Het
Abca5 T C 11: 110,276,521 T1490A probably damaging Het
Akap1 A G 11: 88,845,044 V264A possibly damaging Het
Cggbp1 A G 16: 64,856,003 D144G probably benign Het
Cubn C A 2: 13,404,080 G1352* probably null Het
Cyfip1 T A 7: 55,894,991 M457K possibly damaging Het
Dag1 T C 9: 108,209,252 N230S probably damaging Het
Dbh T C 2: 27,165,730 V72A probably benign Het
Dnah11 A G 12: 117,886,686 S4218P probably damaging Het
Dnah8 A T 17: 30,794,744 I3820F probably damaging Het
Erbb3 C T 10: 128,583,693 C186Y probably damaging Het
Foxd1 T C 13: 98,355,152 I178T probably damaging Het
Gpc5 C T 14: 115,788,179 R470W probably damaging Het
Hace1 G T 10: 45,648,945 R269L probably benign Het
Inpp5a A T 7: 139,478,094 K73* probably null Het
Olfr976 A G 9: 39,956,900 F24L possibly damaging Het
Pzp T C 6: 128,510,390 I504V possibly damaging Het
Scgb1b19 T A 7: 33,288,486 C93S probably damaging Het
Setx TGTGG T 2: 29,154,060 probably null Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Slamf6 G A 1: 171,934,251 V80I probably benign Het
Snapc3 T A 4: 83,435,277 Y184* probably null Het
Spg21 T C 9: 65,486,873 I284T possibly damaging Het
Tas2r123 A T 6: 132,847,316 T59S probably benign Het
Trip11 T G 12: 101,878,827 *139C probably null Het
Trp53inp1 T C 4: 11,164,495 V13A probably benign Het
Wtap C T 17: 12,967,538 R374Q possibly damaging Het
Ydjc A G 16: 17,147,122 E47G possibly damaging Het
Zc3h6 A G 2: 128,993,202 D86G possibly damaging Het
Other mutations in Plekhm3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01603:Plekhm3 APN 1 64921832 missense probably damaging 1.00
IGL01732:Plekhm3 APN 1 64922248 missense probably benign 0.44
IGL02422:Plekhm3 APN 1 64921866 nonsense probably null
IGL02724:Plekhm3 APN 1 64795117 missense probably damaging 0.97
IGL03226:Plekhm3 APN 1 64921800 missense possibly damaging 0.58
IGL03250:Plekhm3 APN 1 64938047 missense possibly damaging 0.65
R0124:Plekhm3 UTSW 1 64921751 missense probably damaging 0.99
R1336:Plekhm3 UTSW 1 64937781 small deletion probably benign
R1467:Plekhm3 UTSW 1 64892882 missense probably damaging 1.00
R1467:Plekhm3 UTSW 1 64892882 missense probably damaging 1.00
R1560:Plekhm3 UTSW 1 64937817 missense probably benign 0.03
R1901:Plekhm3 UTSW 1 64937781 small deletion probably benign
R2432:Plekhm3 UTSW 1 64937856 missense probably damaging 1.00
R2568:Plekhm3 UTSW 1 64937781 small deletion probably benign
R3023:Plekhm3 UTSW 1 64937781 small deletion probably benign
R4496:Plekhm3 UTSW 1 64861236 missense probably damaging 1.00
R4529:Plekhm3 UTSW 1 64937825 missense probably benign 0.14
R4682:Plekhm3 UTSW 1 64937927 missense possibly damaging 0.94
R4969:Plekhm3 UTSW 1 64937919 missense probably damaging 1.00
R5347:Plekhm3 UTSW 1 64819990 missense probably damaging 1.00
R5553:Plekhm3 UTSW 1 64921886 missense possibly damaging 0.89
R5583:Plekhm3 UTSW 1 64937986 nonsense probably null
R5953:Plekhm3 UTSW 1 64937895 missense probably damaging 0.98
R6319:Plekhm3 UTSW 1 64921934 missense probably benign 0.20
R6970:Plekhm3 UTSW 1 64892753 missense possibly damaging 0.80
R7014:Plekhm3 UTSW 1 64883270 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATCCATATGTGGGTACTGGAGAG -3'
(R):5'- CAGCCCCAGATAATCTTTCCTG -3'

Sequencing Primer
(F):5'- CATATGTGGGTACTGGAGAGTCAGC -3'
(R):5'- CAGATAATCTTTCCTGGATGGCAC -3'
Posted On2014-10-30