Incidental Mutation 'R2328:Zc3h6'
ID245748
Institutional Source Beutler Lab
Gene Symbol Zc3h6
Ensembl Gene ENSMUSG00000042851
Gene Namezinc finger CCCH type containing 6
Synonyms
MMRRC Submission 040319-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.261) question?
Stock #R2328 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location128967402-129018563 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 128993202 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 86 (D86G)
Ref Sequence ENSEMBL: ENSMUSP00000105949 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110319] [ENSMUST00000110320]
Predicted Effect possibly damaging
Transcript: ENSMUST00000110319
AA Change: D86G

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000105948
Gene: ENSMUSG00000042851
AA Change: D86G

DomainStartEndE-ValueType
low complexity region 8 25 N/A INTRINSIC
coiled coil region 30 71 N/A INTRINSIC
low complexity region 74 88 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000110320
AA Change: D86G

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000105949
Gene: ENSMUSG00000042851
AA Change: D86G

DomainStartEndE-ValueType
low complexity region 8 25 N/A INTRINSIC
coiled coil region 30 71 N/A INTRINSIC
low complexity region 74 88 N/A INTRINSIC
low complexity region 177 192 N/A INTRINSIC
ZnF_C3H1 271 296 1.72e-4 SMART
ZnF_C3H1 300 325 2.51e-6 SMART
ZnF_C3H1 326 349 5.24e0 SMART
coiled coil region 351 383 N/A INTRINSIC
low complexity region 385 400 N/A INTRINSIC
low complexity region 493 509 N/A INTRINSIC
low complexity region 698 707 N/A INTRINSIC
low complexity region 784 798 N/A INTRINSIC
low complexity region 815 829 N/A INTRINSIC
low complexity region 876 890 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl3 T A 4: 144,455,932 Y322F probably benign Het
Abca5 T C 11: 110,276,521 T1490A probably damaging Het
Akap1 A G 11: 88,845,044 V264A possibly damaging Het
Cggbp1 A G 16: 64,856,003 D144G probably benign Het
Cubn C A 2: 13,404,080 G1352* probably null Het
Cyfip1 T A 7: 55,894,991 M457K possibly damaging Het
Dag1 T C 9: 108,209,252 N230S probably damaging Het
Dbh T C 2: 27,165,730 V72A probably benign Het
Dnah11 A G 12: 117,886,686 S4218P probably damaging Het
Dnah8 A T 17: 30,794,744 I3820F probably damaging Het
Erbb3 C T 10: 128,583,693 C186Y probably damaging Het
Foxd1 T C 13: 98,355,152 I178T probably damaging Het
Gpc5 C T 14: 115,788,179 R470W probably damaging Het
Hace1 G T 10: 45,648,945 R269L probably benign Het
Inpp5a A T 7: 139,478,094 K73* probably null Het
Olfr976 A G 9: 39,956,900 F24L possibly damaging Het
Plekhm3 CCTGCTGCTGCTGCTGCTGCTGCTGC CCTGCTGCTGCTGCTGCTGCTGC 1: 64,937,781 probably benign Het
Pzp T C 6: 128,510,390 I504V possibly damaging Het
Scgb1b19 T A 7: 33,288,486 C93S probably damaging Het
Setx TGTGG T 2: 29,154,060 probably null Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Slamf6 G A 1: 171,934,251 V80I probably benign Het
Snapc3 T A 4: 83,435,277 Y184* probably null Het
Spg21 T C 9: 65,486,873 I284T possibly damaging Het
Tas2r123 A T 6: 132,847,316 T59S probably benign Het
Trip11 T G 12: 101,878,827 *139C probably null Het
Trp53inp1 T C 4: 11,164,495 V13A probably benign Het
Wtap C T 17: 12,967,538 R374Q possibly damaging Het
Ydjc A G 16: 17,147,122 E47G possibly damaging Het
Other mutations in Zc3h6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01732:Zc3h6 APN 2 129011875 missense probably damaging 1.00
IGL01880:Zc3h6 APN 2 129017378 missense probably damaging 0.99
IGL02160:Zc3h6 APN 2 128997685 missense probably benign 0.02
IGL02161:Zc3h6 APN 2 128993226 missense possibly damaging 0.90
IGL02202:Zc3h6 APN 2 129016581 missense probably damaging 1.00
IGL02547:Zc3h6 APN 2 129015611 missense probably benign 0.00
IGL02973:Zc3h6 APN 2 128997795 missense probably damaging 0.98
R0336:Zc3h6 UTSW 2 129015412 missense possibly damaging 0.81
R0420:Zc3h6 UTSW 2 129014827 missense probably benign 0.00
R0538:Zc3h6 UTSW 2 129017223 missense possibly damaging 0.75
R0944:Zc3h6 UTSW 2 129006816 missense probably damaging 1.00
R1151:Zc3h6 UTSW 2 129017136 missense probably benign 0.00
R1528:Zc3h6 UTSW 2 129017069 missense probably benign 0.01
R1698:Zc3h6 UTSW 2 129017358 missense probably benign
R1712:Zc3h6 UTSW 2 129016734 missense probably damaging 1.00
R1913:Zc3h6 UTSW 2 129016620 missense probably damaging 1.00
R1926:Zc3h6 UTSW 2 128997795 missense probably damaging 0.98
R2030:Zc3h6 UTSW 2 129006086 missense probably damaging 1.00
R2051:Zc3h6 UTSW 2 129015618 missense possibly damaging 0.55
R2133:Zc3h6 UTSW 2 128967830 missense possibly damaging 0.53
R2273:Zc3h6 UTSW 2 129014709 missense probably benign 0.01
R2862:Zc3h6 UTSW 2 129015460 missense probably benign 0.43
R2899:Zc3h6 UTSW 2 129002232 missense probably benign 0.00
R3711:Zc3h6 UTSW 2 129017331 missense probably benign 0.00
R3743:Zc3h6 UTSW 2 128997792 missense probably damaging 1.00
R3893:Zc3h6 UTSW 2 129016140 missense probably damaging 1.00
R4748:Zc3h6 UTSW 2 129002240 missense probably damaging 1.00
R5025:Zc3h6 UTSW 2 129010433 missense possibly damaging 0.87
R5026:Zc3h6 UTSW 2 129017309 missense probably benign 0.00
R5125:Zc3h6 UTSW 2 129014479 missense possibly damaging 0.93
R5373:Zc3h6 UTSW 2 129002156 missense possibly damaging 0.75
R5374:Zc3h6 UTSW 2 129002156 missense possibly damaging 0.75
R5703:Zc3h6 UTSW 2 128993452 intron probably benign
R5802:Zc3h6 UTSW 2 129015559 missense possibly damaging 0.56
R5876:Zc3h6 UTSW 2 128993277 missense probably benign 0.29
R5879:Zc3h6 UTSW 2 128997776 unclassified probably null
R5950:Zc3h6 UTSW 2 128997790 nonsense probably null
R6031:Zc3h6 UTSW 2 128967812 missense possibly damaging 0.85
R6031:Zc3h6 UTSW 2 128967812 missense possibly damaging 0.85
R6781:Zc3h6 UTSW 2 129015421 missense probably damaging 0.99
R7323:Zc3h6 UTSW 2 128993411 missense unknown
R7340:Zc3h6 UTSW 2 128993190 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- CCTTAGAGCAAGAATTTCTCAATGT -3'
(R):5'- ATGCCCTTGGACACTCCTT -3'

Sequencing Primer
(F):5'- GAGCAAGAATTTCTCAATGTCATCC -3'
(R):5'- ACCACAGTGATGGCTGAATTCTG -3'
Posted On2014-10-30