Incidental Mutation 'R2330:Zfp7'
ID245850
Institutional Source Beutler Lab
Gene Symbol Zfp7
Ensembl Gene ENSMUSG00000033669
Gene Namezinc finger protein 7
SynonymsKRAB20, Zfp-7, Zfp86-rs1, Zfp65, Zfp80, KRAB7, Krox-2, mszf73-2
MMRRC Submission 040321-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2330 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location76879259-76892395 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 76891309 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 517 (I517T)
Ref Sequence ENSEMBL: ENSMUSP00000155599 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023179] [ENSMUST00000229831] [ENSMUST00000229990] [ENSMUST00000230106] [ENSMUST00000230214]
Predicted Effect probably damaging
Transcript: ENSMUST00000023179
AA Change: I517T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023179
Gene: ENSMUSG00000033669
AA Change: I517T

DomainStartEndE-ValueType
KRAB 4 65 3.07e-33 SMART
ZnF_C2H2 192 214 6.88e-4 SMART
ZnF_C2H2 220 242 4.24e-4 SMART
ZnF_C2H2 248 270 2.09e-3 SMART
ZnF_C2H2 276 298 1.45e-2 SMART
ZnF_C2H2 304 326 1.13e-4 SMART
ZnF_C2H2 332 354 9.08e-4 SMART
ZnF_C2H2 360 383 2.24e-3 SMART
ZnF_C2H2 412 434 9.08e-4 SMART
ZnF_C2H2 440 462 1.67e-2 SMART
ZnF_C2H2 468 490 3.44e-4 SMART
ZnF_C2H2 496 518 8.47e-4 SMART
ZnF_C2H2 524 546 4.54e-4 SMART
ZnF_C2H2 552 574 7.9e-4 SMART
ZnF_C2H2 580 602 1.72e-4 SMART
ZnF_C2H2 633 655 1.98e-4 SMART
ZnF_C2H2 661 683 4.79e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229729
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229782
Predicted Effect probably benign
Transcript: ENSMUST00000229831
Predicted Effect probably benign
Transcript: ENSMUST00000229990
Predicted Effect probably damaging
Transcript: ENSMUST00000230106
AA Change: I517T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000230214
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230954
Meta Mutation Damage Score 0.086 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.1%
Validation Efficiency 100% (31/31)
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp9a A G 2: 168,639,929 S958P probably benign Het
Cdh15 G A 8: 122,856,635 R59H probably benign Het
Clasp2 T C 9: 113,876,304 V594A probably damaging Het
Col12a1 A G 9: 79,633,657 I2396T probably damaging Het
Col1a2 T A 6: 4,528,300 probably benign Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Dnaja3 T A 16: 4,690,016 D127E probably benign Het
Etnppl T C 3: 130,630,575 L332P probably damaging Het
Gm4559 A T 7: 142,274,096 C90S unknown Het
Gramd1c T C 16: 43,983,203 N616D probably benign Het
Hmcn1 A G 1: 150,652,678 probably benign Het
Hydin C A 8: 110,565,009 Q3378K probably benign Het
Lin7b A G 7: 45,369,913 probably null Het
Mex3c G A 18: 73,573,728 V229I probably damaging Het
Micall2 C G 5: 139,717,515 G189R probably damaging Het
Ncam2 A G 16: 81,512,921 H433R probably benign Het
Olfr1259 T C 2: 89,943,953 N54S probably benign Het
Olfr315 A T 11: 58,778,999 S291C probably damaging Het
Olfr774 C T 10: 129,239,039 Q297* probably null Het
Pml A T 9: 58,234,571 V326E probably damaging Het
Prl2c5 T A 13: 13,191,793 M219K possibly damaging Het
Rfc1 A T 5: 65,312,969 I65N possibly damaging Het
Rsbn1 T C 3: 103,914,500 L17P probably damaging Het
Serpina3m A G 12: 104,391,704 K296E possibly damaging Het
Sh3rf1 C T 8: 61,226,287 P121L probably benign Het
Spag6l T C 16: 16,829,085 Q19R probably benign Het
Tgm6 A C 2: 130,143,242 D344A probably damaging Het
Zfp831 T A 2: 174,648,089 Y1216* probably null Het
Other mutations in Zfp7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00576:Zfp7 APN 15 76890901 intron probably benign
IGL01509:Zfp7 APN 15 76881133 missense probably damaging 1.00
IGL01694:Zfp7 APN 15 76890795 nonsense probably null
IGL01731:Zfp7 APN 15 76888305 nonsense probably null
IGL02025:Zfp7 APN 15 76888264 missense probably damaging 1.00
R0841:Zfp7 UTSW 15 76891504 missense probably damaging 1.00
R1345:Zfp7 UTSW 15 76890708 missense probably damaging 1.00
R1625:Zfp7 UTSW 15 76881174 missense probably damaging 1.00
R1872:Zfp7 UTSW 15 76891777 missense probably benign 0.00
R4170:Zfp7 UTSW 15 76891618 missense probably benign 0.00
R4795:Zfp7 UTSW 15 76891346 nonsense probably null
R4796:Zfp7 UTSW 15 76891346 nonsense probably null
R5038:Zfp7 UTSW 15 76891810 missense probably benign 0.01
R5277:Zfp7 UTSW 15 76881203 missense probably damaging 1.00
R5285:Zfp7 UTSW 15 76891222 missense probably damaging 1.00
R5287:Zfp7 UTSW 15 76891222 missense probably damaging 1.00
R5445:Zfp7 UTSW 15 76890854 nonsense probably null
R5655:Zfp7 UTSW 15 76891429 missense probably damaging 1.00
R6320:Zfp7 UTSW 15 76890610 missense possibly damaging 0.79
R7063:Zfp7 UTSW 15 76891719 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- AAGCTTTCAGGTGGCTCTCTC -3'
(R):5'- AATAAGGTATGAGCTCCGGC -3'

Sequencing Primer
(F):5'- TTCTGGAGAGAAACCTTACCAGTGC -3'
(R):5'- CACTCATAGGGCTTTACTCTAACATG -3'
Posted On2014-10-30