Incidental Mutation 'R2330:Spag6l'
ID 245852
Institutional Source Beutler Lab
Gene Symbol Spag6l
Ensembl Gene ENSMUSG00000022783
Gene Name sperm associated antigen 6-like
Synonyms PF16, Spag6
MMRRC Submission 040321-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.297) question?
Stock # R2330 (G1)
Quality Score 225
Status Validated
Chromosome 16
Chromosomal Location 16570880-16647227 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 16646949 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Arginine at position 19 (Q19R)
Ref Sequence ENSEMBL: ENSMUSP00000023468 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023468]
AlphaFold Q9JLI7
Predicted Effect probably benign
Transcript: ENSMUST00000023468
AA Change: Q19R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000023468
Gene: ENSMUSG00000022783
AA Change: Q19R

DomainStartEndE-ValueType
ARM 30 70 2.26e-3 SMART
Blast:ARM 72 112 3e-15 BLAST
ARM 114 154 3e-8 SMART
ARM 156 196 4.91e-4 SMART
ARM 198 238 1.03e-6 SMART
ARM 240 280 3.13e0 SMART
ARM 282 322 4.82e1 SMART
ARM 323 365 7.34e-3 SMART
Blast:ARM 367 409 7e-16 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125017
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132033
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141835
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147539
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151132
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154624
Meta Mutation Damage Score 0.0597 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.1%
Validation Efficiency 100% (31/31)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The correlation of anti-sperm antibodies with cases of unexplained infertility implicates a role for these antibodies in blocking fertilization. Improved diagnosis and treatment of immunologic infertility, as well as identification of proteins for targeted contraception, are dependent on the identification and characterization of relevant sperm antigens. The protein expressed by this gene is recognized by anti-sperm antibodies from an infertile man. This protein localizes to the tail of permeabilized human sperm and contains eight contiguous armadillo repeats, a motif known to mediate protein-protein interactions. Studies in mice suggest that this protein is involved in sperm flagellar motility and maintenance of the structural integrity of mature sperm. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Many homozygotes for a targeted null mutation exhibit reduced growth, hydrocephaly, and lethality by 8 weeks of age. Surviving males have sperm defects and are infertile, while females show reduced fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp9a A G 2: 168,481,849 (GRCm39) S958P probably benign Het
Cdh15 G A 8: 123,583,374 (GRCm39) R59H probably benign Het
Clasp2 T C 9: 113,705,372 (GRCm39) V594A probably damaging Het
Col12a1 A G 9: 79,540,939 (GRCm39) I2396T probably damaging Het
Col1a2 T A 6: 4,528,300 (GRCm39) probably benign Het
Crygs C T 16: 22,624,301 (GRCm39) G102D possibly damaging Het
Dnaja3 T A 16: 4,507,880 (GRCm39) D127E probably benign Het
Etnppl T C 3: 130,424,224 (GRCm39) L332P probably damaging Het
Gm4559 A T 7: 141,827,833 (GRCm39) C90S unknown Het
Gramd1c T C 16: 43,803,566 (GRCm39) N616D probably benign Het
Hmcn1 A G 1: 150,528,429 (GRCm39) probably benign Het
Hydin C A 8: 111,291,641 (GRCm39) Q3378K probably benign Het
Lin7b A G 7: 45,019,337 (GRCm39) probably null Het
Mex3c G A 18: 73,706,799 (GRCm39) V229I probably damaging Het
Micall2 C G 5: 139,703,270 (GRCm39) G189R probably damaging Het
Ncam2 A G 16: 81,309,809 (GRCm39) H433R probably benign Het
Or2t45 A T 11: 58,669,825 (GRCm39) S291C probably damaging Het
Or4c12 T C 2: 89,774,297 (GRCm39) N54S probably benign Het
Or6c5 C T 10: 129,074,908 (GRCm39) Q297* probably null Het
Pml A T 9: 58,141,854 (GRCm39) V326E probably damaging Het
Prl2c5 T A 13: 13,366,378 (GRCm39) M219K possibly damaging Het
Rfc1 A T 5: 65,470,312 (GRCm39) I65N possibly damaging Het
Rsbn1 T C 3: 103,821,816 (GRCm39) L17P probably damaging Het
Serpina3m A G 12: 104,357,963 (GRCm39) K296E possibly damaging Het
Sh3rf1 C T 8: 61,679,321 (GRCm39) P121L probably benign Het
Tgm6 A C 2: 129,985,162 (GRCm39) D344A probably damaging Het
Zfp7 T C 15: 76,775,509 (GRCm39) I517T probably damaging Het
Zfp831 T A 2: 174,489,882 (GRCm39) Y1216* probably null Het
Other mutations in Spag6l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00864:Spag6l APN 16 16,598,597 (GRCm39) missense probably benign 0.20
IGL00928:Spag6l APN 16 16,584,877 (GRCm39) missense possibly damaging 0.52
IGL00929:Spag6l APN 16 16,584,877 (GRCm39) missense possibly damaging 0.52
IGL01793:Spag6l APN 16 16,599,721 (GRCm39) missense probably damaging 1.00
IGL02380:Spag6l APN 16 16,581,033 (GRCm39) critical splice acceptor site probably null
IGL03271:Spag6l APN 16 16,598,592 (GRCm39) missense probably damaging 1.00
R0284:Spag6l UTSW 16 16,598,630 (GRCm39) missense probably damaging 0.99
R0394:Spag6l UTSW 16 16,598,493 (GRCm39) missense probably benign
R0720:Spag6l UTSW 16 16,584,960 (GRCm39) splice site probably benign
R1205:Spag6l UTSW 16 16,605,171 (GRCm39) missense probably damaging 1.00
R1496:Spag6l UTSW 16 16,598,478 (GRCm39) splice site probably benign
R1707:Spag6l UTSW 16 16,598,492 (GRCm39) missense probably benign 0.00
R1926:Spag6l UTSW 16 16,580,921 (GRCm39) missense probably benign 0.00
R2255:Spag6l UTSW 16 16,595,203 (GRCm39) missense probably damaging 0.96
R3755:Spag6l UTSW 16 16,580,884 (GRCm39) critical splice donor site probably null
R3796:Spag6l UTSW 16 16,580,916 (GRCm39) missense probably damaging 1.00
R4093:Spag6l UTSW 16 16,646,888 (GRCm39) missense probably benign 0.05
R4324:Spag6l UTSW 16 16,605,099 (GRCm39) missense probably benign 0.00
R4725:Spag6l UTSW 16 16,610,395 (GRCm39) missense probably damaging 1.00
R4766:Spag6l UTSW 16 16,595,254 (GRCm39) missense probably benign 0.03
R4877:Spag6l UTSW 16 16,599,622 (GRCm39) missense possibly damaging 0.47
R5753:Spag6l UTSW 16 16,584,831 (GRCm39) critical splice donor site probably null
R5958:Spag6l UTSW 16 16,580,885 (GRCm39) critical splice donor site probably null
R6107:Spag6l UTSW 16 16,599,652 (GRCm39) missense possibly damaging 0.56
R6894:Spag6l UTSW 16 16,601,802 (GRCm39) missense probably damaging 1.00
R7329:Spag6l UTSW 16 16,584,883 (GRCm39) missense probably benign
R7634:Spag6l UTSW 16 16,595,278 (GRCm39) missense probably damaging 0.97
R8240:Spag6l UTSW 16 16,580,889 (GRCm39) missense probably damaging 1.00
R8464:Spag6l UTSW 16 16,580,898 (GRCm39) missense probably damaging 0.97
R9207:Spag6l UTSW 16 16,598,492 (GRCm39) missense probably benign 0.00
R9682:Spag6l UTSW 16 16,646,981 (GRCm39) critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TACAGCTGATGGGAGTCAGG -3'
(R):5'- CGCATACACAGAGGAACGGATC -3'

Sequencing Primer
(F):5'- CTGATGGGAGTCAGGGGATG -3'
(R):5'- CACTACCAGCTCAACGGTG -3'
Posted On 2014-10-30