Mutagenetix > Incidental Mutation

Incidental Mutation 'R2331:Aff3'

245858

Institutional Source

Beutler Lab

Gene Symbol

Aff3

Ensembl Gene

ENSMUSG00000037138

Gene Name

AF4/FMR2 family, member 3

Synonyms

LAF-4, 3222402O04Rik, Laf4

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2331 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

38216407-38704036 bp(-) (GRCm39)

Type of Mutation

splice site

DNA Base Change (assembly)

C to T at 38243971 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000092637 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039827] [ENSMUST00000095027]

AlphaFold

P51827

Predicted Effect

probably null
Transcript: ENSMUST00000039827

SMART Domains

Protein: ENSMUSP00000044128
Gene: ENSMUSG00000037138

Domain	Start	End	E-Value	Type
Pfam:AF-4	20	170	4.9e-63	PFAM
Pfam:AF-4	160	1226	N/A	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000095027

SMART Domains

Protein: ENSMUSP00000092637
Gene: ENSMUSG00000037138

Domain	Start	End	E-Value	Type
Pfam:AF-4	20	172	1.7e-47	PFAM
Pfam:AF-4	161	1226	3.8e-268	PFAM

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.1%
20x: 94.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a tissue-restricted nuclear transcriptional activator that is preferentially expressed in lymphoid tissue. Isolation of this protein initially defined a highly conserved LAF4/MLLT2 gene family of nuclear transcription factors that may function in lymphoid development and oncogenesis. In some ALL patients, this gene has been found fused to the gene for MLL. Multiple alternatively spliced transcript variants that encode different proteins have been found for this gene. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 26 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Cadps	A	G	14: 12,603,692 (GRCm38)	I376T	probably damaging	Het
Crygs	C	T	16: 22,624,301 (GRCm39)	G102D	possibly damaging	Het
Gm10295	A	C	7: 71,000,437 (GRCm39)	S48A	unknown	Het
Gstcd	A	G	3: 132,704,641 (GRCm39)	C538R	probably damaging	Het
Hcn3	A	T	3: 89,055,397 (GRCm39)	S617T	probably benign	Het
Hectd4	A	G	5: 121,458,089 (GRCm39)	I752V	probably benign	Het
Itgb7	G	T	15: 102,131,983 (GRCm39)	T200K	probably damaging	Het
Lcn11	C	A	2: 25,670,188 (GRCm39)	T177K	possibly damaging	Het
Lsm14a	A	G	7: 34,056,915 (GRCm39)	V241A	probably benign	Het
Magi1	T	C	6: 93,662,543 (GRCm39)	K1075E	probably damaging	Het
Or4c111	T	C	2: 88,844,265 (GRCm39)	I48V	probably benign	Het
Or4d10c	C	A	19: 12,065,522 (GRCm39)	L211F	probably benign	Het
P4hb	T	C	11: 120,459,106 (GRCm39)	N129S	probably benign	Het
Piezo1	C	T	8: 123,214,005 (GRCm39)		probably null	Het
Ppp3ca	T	C	3: 136,503,580 (GRCm39)	M51T	probably benign	Het
Sema6d	T	C	2: 124,499,983 (GRCm39)	V353A	probably damaging	Het
Setx	GTGGCT	GT	2: 29,044,073 (GRCm39)	1814	probably null	Het
Sh3rf1	C	T	8: 61,679,321 (GRCm39)	P121L	probably benign	Het
Sh3rf2	T	C	18: 42,186,928 (GRCm39)	F16L	probably benign	Het
Sparcl1	A	G	5: 104,233,660 (GRCm39)	L563P	probably damaging	Het
Stra6l	T	C	4: 45,858,224 (GRCm39)		probably null	Het
Sult2a6	A	T	7: 13,959,795 (GRCm39)	M246K	possibly damaging	Het
Trpv5	A	G	6: 41,636,902 (GRCm39)	S399P	probably damaging	Het
Uggt2	A	T	14: 119,264,011 (GRCm39)	F1006L	possibly damaging	Het
Uhrf1	C	A	17: 56,617,671 (GRCm39)		probably null	Het
Wdr72	A	G	9: 74,055,608 (GRCm39)	Y279C	probably damaging	Het

Other mutations in Aff3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01364:Aff3	APN	1	38,574,762 (GRCm39)	missense	probably damaging	1.00
IGL02263:Aff3	APN	1	38,574,680 (GRCm39)	missense	probably damaging	1.00
IGL02962:Aff3	APN	1	38,574,737 (GRCm39)	missense	probably damaging	1.00
IGL03003:Aff3	APN	1	38,248,651 (GRCm39)	missense	probably damaging	1.00
IGL03180:Aff3	APN	1	38,574,743 (GRCm39)	missense	probably damaging	1.00
IGL03389:Aff3	APN	1	38,249,430 (GRCm39)	missense	possibly damaging	0.62
PIT4377001:Aff3	UTSW	1	38,578,044 (GRCm39)	missense	probably damaging	0.99
PIT4544001:Aff3	UTSW	1	38,249,443 (GRCm39)	missense	probably benign	0.01
R0004:Aff3	UTSW	1	38,308,807 (GRCm39)	missense	possibly damaging	0.46
R0004:Aff3	UTSW	1	38,308,807 (GRCm39)	missense	possibly damaging	0.46
R0026:Aff3	UTSW	1	38,242,974 (GRCm39)	missense	probably benign	0.00
R0279:Aff3	UTSW	1	38,574,650 (GRCm39)	missense	probably damaging	1.00
R0344:Aff3	UTSW	1	38,243,013 (GRCm39)	missense	probably benign
R0375:Aff3	UTSW	1	38,244,021 (GRCm39)	missense	possibly damaging	0.46
R0605:Aff3	UTSW	1	38,249,068 (GRCm39)	missense	probably damaging	1.00
R0613:Aff3	UTSW	1	38,249,004 (GRCm39)	missense	probably benign	0.09
R0742:Aff3	UTSW	1	38,666,189 (GRCm39)	missense	probably damaging	0.99
R1156:Aff3	UTSW	1	38,243,991 (GRCm39)	missense	probably benign
R1255:Aff3	UTSW	1	38,243,965 (GRCm39)	splice site	probably null
R1448:Aff3	UTSW	1	38,230,364 (GRCm39)	missense	probably damaging	1.00
R1760:Aff3	UTSW	1	38,368,945 (GRCm39)	splice site	probably benign
R1780:Aff3	UTSW	1	38,574,783 (GRCm39)	missense	probably damaging	1.00
R1855:Aff3	UTSW	1	38,249,385 (GRCm39)	missense	probably benign	0.23
R2011:Aff3	UTSW	1	38,246,996 (GRCm39)	missense	probably benign	0.01
R2965:Aff3	UTSW	1	38,248,791 (GRCm39)	missense	probably damaging	1.00
R2970:Aff3	UTSW	1	38,574,103 (GRCm39)	missense	probably damaging	0.97
R3015:Aff3	UTSW	1	38,249,649 (GRCm39)	missense	probably benign	0.00
R3763:Aff3	UTSW	1	38,291,770 (GRCm39)	splice site	probably benign
R4174:Aff3	UTSW	1	38,247,008 (GRCm39)	missense	probably damaging	0.96
R4436:Aff3	UTSW	1	38,248,768 (GRCm39)	missense	possibly damaging	0.75
R4661:Aff3	UTSW	1	38,666,209 (GRCm39)	missense	possibly damaging	0.94
R5069:Aff3	UTSW	1	38,220,694 (GRCm39)	critical splice donor site	probably null
R5566:Aff3	UTSW	1	38,220,505 (GRCm39)	missense	probably damaging	1.00
R6023:Aff3	UTSW	1	38,257,451 (GRCm39)	missense	probably damaging	1.00
R6209:Aff3	UTSW	1	38,232,670 (GRCm39)	missense	probably benign	0.28
R6467:Aff3	UTSW	1	38,247,098 (GRCm39)	missense	probably benign	0.25
R6748:Aff3	UTSW	1	38,574,327 (GRCm39)	missense	probably damaging	1.00
R6862:Aff3	UTSW	1	38,445,578 (GRCm39)	missense	possibly damaging	0.87
R6880:Aff3	UTSW	1	38,666,209 (GRCm39)	missense	possibly damaging	0.94
R6880:Aff3	UTSW	1	38,574,243 (GRCm39)	missense	probably damaging	0.99
R7187:Aff3	UTSW	1	38,257,478 (GRCm39)	missense	probably damaging	0.98
R8322:Aff3	UTSW	1	38,220,742 (GRCm39)	missense	possibly damaging	0.65
R8329:Aff3	UTSW	1	38,244,135 (GRCm39)	missense	probably benign	0.13
R8737:Aff3	UTSW	1	38,308,810 (GRCm39)	missense	probably damaging	1.00
R9093:Aff3	UTSW	1	38,291,738 (GRCm39)	missense	possibly damaging	0.81
R9146:Aff3	UTSW	1	38,359,200 (GRCm39)	missense	probably benign	0.27
R9149:Aff3	UTSW	1	38,220,397 (GRCm39)	missense	probably damaging	1.00
R9157:Aff3	UTSW	1	38,249,559 (GRCm39)	missense	probably benign	0.45
R9446:Aff3	UTSW	1	38,574,337 (GRCm39)	missense	probably benign	0.30
R9581:Aff3	UTSW	1	38,249,266 (GRCm39)	missense	probably benign
R9645:Aff3	UTSW	1	38,249,121 (GRCm39)	missense	probably damaging	1.00
R9674:Aff3	UTSW	1	38,248,864 (GRCm39)	missense	probably damaging	1.00
Z1176:Aff3	UTSW	1	38,368,953 (GRCm39)	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- CATGGGTGGAGGACCTGG -3'
(R):5'- GTTTCTCTTTTCAGCTTGGCAAT -3'

Sequencing Primer
(F):5'- CTGCTAAAACAGATCGCTGACTTAG -3'
(R):5'- CAAAAATGAAAAGATGCTCCGGTC -3'

Posted On

2014-10-30