Incidental Mutation 'R2331:Crygs'
ID 245884
Institutional Source Beutler Lab
Gene Symbol Crygs
Ensembl Gene ENSMUSG00000033501
Gene Name crystallin, gamma S
Synonyms Opj
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2331 (G1)
Quality Score 225
Status Not validated
Chromosome 16
Chromosomal Location 22623953-22630160 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 22624301 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Aspartic acid at position 102 (G102D)
Ref Sequence ENSEMBL: ENSMUSP00000043588 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040592]
AlphaFold O35486
PDB Structure NMR structure of murine gamma-S crystallin [SOLUTION NMR]
NMR structure of murine gamma-S crystallin [SOLUTION NMR]
NMR structure of murine gamma-S crystallin from joint refinement with SAXS data [SOLUTION NMR]
Predicted Effect possibly damaging
Transcript: ENSMUST00000040592
AA Change: G102D

PolyPhen 2 Score 0.927 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000043588
Gene: ENSMUSG00000033501
AA Change: G102D

DomainStartEndE-ValueType
XTALbg 7 86 5.98e-40 SMART
XTALbg 95 176 6.26e-43 SMART
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Crystallins are separated into two classes: taxon-specific, or enzyme, and ubiquitous. The latter class constitutes the major proteins of vertebrate eye lens and maintains the transparency and refractive index of the lens. Since lens central fiber cells lose their nuclei during development, these crystallins are made and then retained throughout life, making them extremely stable proteins. Mammalian lens crystallins are divided into alpha, beta, and gamma families; beta and gamma crystallins are also considered as a superfamily. Alpha and beta families are further divided into acidic and basic groups. Seven protein regions exist in crystallins: four homologous motifs, a connecting peptide, and N- and C-terminal extensions. Gamma-crystallins are a homogeneous group of highly symmetrical, monomeric proteins typically lacking connecting peptides and terminal extensions. They are differentially regulated after early development. This gene encodes a protein initially considered to be a beta-crystallin but the encoded protein is monomeric and has greater sequence similarity to other gamma-crystallins. This gene encodes the most significant gamma-crystallin in adult eye lens tissue. Whether due to aging or mutations in specific genes, gamma-crystallins have been involved in cataract formation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations in this gene can cause cataracts and/or disrupted lens fiber cell morphology and organization. Aging mice homozygous for a knock-out allele do not develop cataracts but show focusing defects associated with inefficient clearance of cellular organelles and altered actin distribution. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aff3 C T 1: 38,243,971 (GRCm39) probably null Het
Cadps A G 14: 12,603,692 (GRCm38) I376T probably damaging Het
Gm10295 A C 7: 71,000,437 (GRCm39) S48A unknown Het
Gstcd A G 3: 132,704,641 (GRCm39) C538R probably damaging Het
Hcn3 A T 3: 89,055,397 (GRCm39) S617T probably benign Het
Hectd4 A G 5: 121,458,089 (GRCm39) I752V probably benign Het
Itgb7 G T 15: 102,131,983 (GRCm39) T200K probably damaging Het
Lcn11 C A 2: 25,670,188 (GRCm39) T177K possibly damaging Het
Lsm14a A G 7: 34,056,915 (GRCm39) V241A probably benign Het
Magi1 T C 6: 93,662,543 (GRCm39) K1075E probably damaging Het
Or4c111 T C 2: 88,844,265 (GRCm39) I48V probably benign Het
Or4d10c C A 19: 12,065,522 (GRCm39) L211F probably benign Het
P4hb T C 11: 120,459,106 (GRCm39) N129S probably benign Het
Piezo1 C T 8: 123,214,005 (GRCm39) probably null Het
Ppp3ca T C 3: 136,503,580 (GRCm39) M51T probably benign Het
Sema6d T C 2: 124,499,983 (GRCm39) V353A probably damaging Het
Setx GTGGCT GT 2: 29,044,073 (GRCm39) 1814 probably null Het
Sh3rf1 C T 8: 61,679,321 (GRCm39) P121L probably benign Het
Sh3rf2 T C 18: 42,186,928 (GRCm39) F16L probably benign Het
Sparcl1 A G 5: 104,233,660 (GRCm39) L563P probably damaging Het
Stra6l T C 4: 45,858,224 (GRCm39) probably null Het
Sult2a6 A T 7: 13,959,795 (GRCm39) M246K possibly damaging Het
Trpv5 A G 6: 41,636,902 (GRCm39) S399P probably damaging Het
Uggt2 A T 14: 119,264,011 (GRCm39) F1006L possibly damaging Het
Uhrf1 C A 17: 56,617,671 (GRCm39) probably null Het
Wdr72 A G 9: 74,055,608 (GRCm39) Y279C probably damaging Het
Other mutations in Crygs
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00899:Crygs APN 16 22,625,312 (GRCm39) missense possibly damaging 0.81
R1694:Crygs UTSW 16 22,625,425 (GRCm39) splice site probably null
R1932:Crygs UTSW 16 22,625,304 (GRCm39) missense probably benign 0.12
R2206:Crygs UTSW 16 22,624,301 (GRCm39) missense possibly damaging 0.93
R2207:Crygs UTSW 16 22,624,301 (GRCm39) missense possibly damaging 0.93
R2275:Crygs UTSW 16 22,624,301 (GRCm39) missense possibly damaging 0.93
R2298:Crygs UTSW 16 22,624,301 (GRCm39) missense possibly damaging 0.93
R2299:Crygs UTSW 16 22,624,301 (GRCm39) missense possibly damaging 0.93
R2300:Crygs UTSW 16 22,624,301 (GRCm39) missense possibly damaging 0.93
R2326:Crygs UTSW 16 22,624,301 (GRCm39) missense possibly damaging 0.93
R2329:Crygs UTSW 16 22,624,301 (GRCm39) missense possibly damaging 0.93
R2330:Crygs UTSW 16 22,624,301 (GRCm39) missense possibly damaging 0.93
R2332:Crygs UTSW 16 22,624,301 (GRCm39) missense possibly damaging 0.93
R2857:Crygs UTSW 16 22,624,301 (GRCm39) missense possibly damaging 0.93
R2895:Crygs UTSW 16 22,624,301 (GRCm39) missense possibly damaging 0.93
R2896:Crygs UTSW 16 22,624,301 (GRCm39) missense possibly damaging 0.93
R2921:Crygs UTSW 16 22,624,301 (GRCm39) missense possibly damaging 0.93
R2922:Crygs UTSW 16 22,624,301 (GRCm39) missense possibly damaging 0.93
R3120:Crygs UTSW 16 22,624,301 (GRCm39) missense possibly damaging 0.93
R3196:Crygs UTSW 16 22,624,301 (GRCm39) missense possibly damaging 0.93
R3427:Crygs UTSW 16 22,624,301 (GRCm39) missense possibly damaging 0.93
R3609:Crygs UTSW 16 22,624,301 (GRCm39) missense possibly damaging 0.93
R3611:Crygs UTSW 16 22,624,301 (GRCm39) missense possibly damaging 0.93
R3625:Crygs UTSW 16 22,624,301 (GRCm39) missense possibly damaging 0.93
R3693:Crygs UTSW 16 22,624,301 (GRCm39) missense possibly damaging 0.93
R3694:Crygs UTSW 16 22,624,301 (GRCm39) missense possibly damaging 0.93
R3695:Crygs UTSW 16 22,624,301 (GRCm39) missense possibly damaging 0.93
R3870:Crygs UTSW 16 22,624,301 (GRCm39) missense possibly damaging 0.93
R3871:Crygs UTSW 16 22,624,301 (GRCm39) missense possibly damaging 0.93
R3876:Crygs UTSW 16 22,625,262 (GRCm39) missense probably damaging 1.00
R4052:Crygs UTSW 16 22,624,301 (GRCm39) missense possibly damaging 0.93
R4207:Crygs UTSW 16 22,624,301 (GRCm39) missense possibly damaging 0.93
R4299:Crygs UTSW 16 22,624,161 (GRCm39) nonsense probably null
R4630:Crygs UTSW 16 22,624,268 (GRCm39) missense possibly damaging 0.90
R7392:Crygs UTSW 16 22,625,252 (GRCm39) missense probably benign 0.35
R7573:Crygs UTSW 16 22,624,069 (GRCm39) makesense probably null
R7954:Crygs UTSW 16 22,624,082 (GRCm39) missense probably damaging 1.00
R7955:Crygs UTSW 16 22,624,082 (GRCm39) missense probably damaging 1.00
R7957:Crygs UTSW 16 22,624,082 (GRCm39) missense probably damaging 1.00
R8172:Crygs UTSW 16 22,625,292 (GRCm39) missense probably damaging 1.00
R9653:Crygs UTSW 16 22,625,304 (GRCm39) missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- AGAACTCTATGGTCCCACTCC -3'
(R):5'- AGAGTTCTGATGACCCTCCC -3'

Sequencing Primer
(F):5'- TCACTCCACAATGCGGCG -3'
(R):5'- TGATGACCCTCCCTTAAGGATGAG -3'
Posted On 2014-10-30